ID: 1015381948

View in Genome Browser
Species Human (GRCh38)
Location 6:132579824-132579846
Sequence GTAAGAGGCAGACTGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015381944_1015381948 -9 Left 1015381944 6:132579810-132579832 CCCGAGCAGTGTTGGTAAGAGGC No data
Right 1015381948 6:132579824-132579846 GTAAGAGGCAGACTGGGATTTGG No data
1015381945_1015381948 -10 Left 1015381945 6:132579811-132579833 CCGAGCAGTGTTGGTAAGAGGCA No data
Right 1015381948 6:132579824-132579846 GTAAGAGGCAGACTGGGATTTGG No data
1015381942_1015381948 -8 Left 1015381942 6:132579809-132579831 CCCCGAGCAGTGTTGGTAAGAGG No data
Right 1015381948 6:132579824-132579846 GTAAGAGGCAGACTGGGATTTGG No data
1015381939_1015381948 15 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381948 6:132579824-132579846 GTAAGAGGCAGACTGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015381948 Original CRISPR GTAAGAGGCAGACTGGGATT TGG Intergenic
No off target data available for this crispr