ID: 1015382886

View in Genome Browser
Species Human (GRCh38)
Location 6:132589566-132589588
Sequence AGGCCAGGTAGATGACCAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015382882_1015382886 8 Left 1015382882 6:132589535-132589557 CCTAGCACGATAATCAGCATGCC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG 0: 1
1: 0
2: 1
3: 3
4: 90
1015382881_1015382886 9 Left 1015382881 6:132589534-132589556 CCCTAGCACGATAATCAGCATGC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG 0: 1
1: 0
2: 1
3: 3
4: 90
1015382880_1015382886 22 Left 1015382880 6:132589521-132589543 CCACAAATACATTCCCTAGCACG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015382886 Original CRISPR AGGCCAGGTAGATGACCAAC TGG Exonic
900523501 1:3117292-3117314 AGGCCAGGGCCATGACCACCAGG - Intronic
900581022 1:3409298-3409320 GGGCCAGGTAGGTGACCGAGGGG + Intronic
912552536 1:110493474-110493496 AGGCCATGAGGAAGACCAACAGG - Intergenic
915934806 1:160084210-160084232 AGGCCAGGACGAAGAACAACAGG - Exonic
916736551 1:167612508-167612530 AGTCCAGGTATATGACTAACTGG - Intergenic
1069878739 10:71578795-71578817 AGGCCAGGTTGATGGCCGAAAGG + Intronic
1071925749 10:90407157-90407179 AGGGCAGGGAGAAGACCAAGTGG - Intergenic
1075994997 10:126870008-126870030 AGGCCAGATAGTTGACCATGGGG - Intergenic
1081485852 11:43528036-43528058 ATGCAAGGTCGATGACCCACCGG + Intergenic
1083735064 11:64675488-64675510 AGGCCAGGCAGCTGCCCCACGGG + Intronic
1084030971 11:66480366-66480388 AGGCCAGGCAGTTGGCCAAGGGG + Exonic
1087076293 11:94129450-94129472 AGGCCAGCGAGATGAGCAGCAGG - Exonic
1096104625 12:48989786-48989808 TGGCCAGATAGATGACAAATAGG + Intergenic
1096528790 12:52230766-52230788 GGGGCAGGCAGATGACCAATGGG + Intergenic
1103598220 12:122037208-122037230 AGGCCAGGCAGGTGACAAAGAGG - Intronic
1108363211 13:49686374-49686396 AGGCCAGGTAGAGGAGAAGCTGG - Intronic
1109719934 13:66262862-66262884 AGTCCATGTAGATAAACAACTGG - Intergenic
1114819803 14:26005000-26005022 AGGTCAGGTAGATTACCAGTTGG + Intergenic
1118044790 14:61956074-61956096 ATGGCATGTAAATGACCAACAGG - Intergenic
1119832356 14:77714829-77714851 AGTCCCTGTAGATGACAAACTGG - Intronic
1122188602 14:100021867-100021889 AGGACAGGTAGGTGAACCACCGG + Intronic
1123704849 15:22943863-22943885 AGGCCAGGGCGAGGACCACCAGG + Intronic
1126374967 15:47988538-47988560 AGGCCAGGTAAATCATCAGCAGG - Intergenic
1129161291 15:73749413-73749435 ATGCCTGGAAGATGCCCAACTGG + Intronic
1129771739 15:78207190-78207212 GGGCCAAGAAGAGGACCAACTGG - Intronic
1131871948 15:96772690-96772712 AGGCCAGAAAGATGCCCAAAAGG - Intergenic
1138272194 16:55703282-55703304 AGGCCAGGTGGGTGCCCAAAGGG + Intronic
1149557465 17:57584385-57584407 CGGGCAGGCAGATGACCATCGGG - Intronic
1150648483 17:66994654-66994676 AGTTCTGGGAGATGACCAACTGG - Intronic
1156503994 18:37577576-37577598 AGGCCAGGGATCTGACCGACAGG - Intergenic
1156854234 18:41763669-41763691 AGGCCAGGCAAATTACTAACAGG + Intergenic
1158895074 18:61905138-61905160 AGGCAACATAGACGACCAACGGG - Intergenic
1160788660 19:912937-912959 AGCCCCGGAAGATGAGCAACGGG + Intronic
1166419000 19:42620014-42620036 AGACCAGGGAGAAGACCTACAGG + Intronic
1166687200 19:44802473-44802495 AGGCAAGGTGGATAACCATCAGG - Intergenic
1167532623 19:50027611-50027633 GGGCCAGGCAGATGACATACAGG + Intronic
928361261 2:30663982-30664004 AGGGCAGGTAGATGACCAAAGGG - Intergenic
931441965 2:62296440-62296462 AGGACAGGTAAATAACCAAAGGG + Intergenic
935986404 2:108677543-108677565 AGGGCAGGTTGATGAGGAACAGG - Intronic
945381173 2:209142681-209142703 AAGGCATATAGATGACCAACAGG + Intergenic
1172425815 20:34855240-34855262 AGGCCAGGAATATGAACATCTGG - Intronic
1173658299 20:44716011-44716033 AGACAAGGTAGATGTCCCACAGG - Intronic
1179113519 21:38468266-38468288 AGGCCTGGTAGCAGCCCAACAGG - Intronic
1185279179 22:49962601-49962623 AGGCCAGGGAGTTAACCAGCAGG + Intronic
950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG + Intronic
954733512 3:52685693-52685715 AGGCCCGGCAGCTGACCAAGGGG + Intronic
955903528 3:63782944-63782966 AGGACAGTTAGATGACTAATGGG + Intergenic
956230420 3:67009264-67009286 AGTCCAGTTAGATGAATAACTGG - Exonic
956915982 3:73871359-73871381 TGGCCAGGAAGATGAGCAGCTGG - Intergenic
963362116 3:144287868-144287890 ATGCATGGTAGATGACAAACAGG + Intergenic
966015716 3:175133990-175134012 AGGCCAGATAGATGATTATCTGG - Intronic
968331310 3:197872917-197872939 AGGCCAGGAAGATAACAAGCCGG + Intronic
973260915 4:48162191-48162213 ATGCCCAGTAGATGACCAAGGGG - Intronic
975289548 4:72660819-72660841 AGGCCAGGAAGATAACCTAAGGG + Intergenic
975642343 4:76512808-76512830 AGACCAGAGATATGACCAACTGG + Intronic
978823023 4:112987543-112987565 AGGACAAGGAAATGACCAACTGG + Intronic
979528942 4:121747899-121747921 AGGCCAGGTAGATAGCCTAAAGG - Intergenic
981954131 4:150448989-150449011 AGGCAAGGTAGAAGACCAGGGGG + Intronic
982487401 4:155983128-155983150 ATGCCATGCACATGACCAACTGG - Intergenic
985215341 4:187647152-187647174 AAGCCATGCAGATGGCCAACAGG + Intergenic
989028310 5:37091119-37091141 AGGCCAGGGAGCTGACAATCTGG - Intergenic
989266600 5:39481885-39481907 AGGCCAGCTAAAAGACCACCTGG - Intergenic
991241367 5:64464705-64464727 AGAACAGGTATATGACCAACAGG + Intergenic
991431134 5:66548751-66548773 AGGCCAGGAAAATAACCATCAGG - Intergenic
992590889 5:78294760-78294782 AGGCCTGCTAGATTACCACCCGG + Intergenic
998878586 5:146624853-146624875 AGGGCAGAAAGATGACCAGCTGG - Intronic
1005501287 6:26431102-26431124 AGTCCAGGAAGATGCCCACCTGG - Intergenic
1011034271 6:82956419-82956441 TGGCCAGCAAGATGACCAACAGG - Intronic
1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG + Exonic
1015999757 6:139030042-139030064 AGGCGAGGTAGATGACGGCCAGG - Intronic
1016863923 6:148747592-148747614 AGCCCAGGCAGAAGACCAGCAGG - Exonic
1019827561 7:3297312-3297334 AGGTGAGGTAGATGGCCCACGGG + Intergenic
1021084041 7:16400395-16400417 AGGCCTGGCACATGACTAACAGG + Intronic
1023033372 7:36109697-36109719 AGGCCAGGTAGGGGACTAGCAGG + Intergenic
1030129946 7:106190779-106190801 ATCCCAGATGGATGACCAACAGG + Intergenic
1030951960 7:115802064-115802086 AGTCCTGGGAGCTGACCAACTGG + Intergenic
1037468531 8:19184596-19184618 AGGCCAGGGAGATGCTCAGCAGG + Intergenic
1041855235 8:62445293-62445315 AAGACACGTAGATGGCCAACAGG - Intronic
1043255918 8:78136519-78136541 AGGACATTTAGATGACCAGCAGG - Intergenic
1048095553 8:131288736-131288758 AGACCATGTAGATGACTAATGGG + Intergenic
1048285076 8:133135196-133135218 AGTGGAGGTAGAAGACCAACTGG + Intergenic
1048437790 8:134433830-134433852 AGGCCAGGTGGGTGAGCAGCTGG - Intergenic
1048925376 8:139266570-139266592 AGGCCAGGGAGATGAGGAAACGG + Intergenic
1051005928 9:12344497-12344519 AGGCCATGCAAATGACAAACAGG + Intergenic
1052834446 9:33240220-33240242 AGGCCAGGGCGATTACCCACTGG - Exonic
1057906248 9:98985806-98985828 GGCCCAGGTAGATGACCTTCTGG - Exonic
1059346831 9:113634659-113634681 AGGCCTGGTGGATGACGGACTGG + Intergenic
1059761771 9:117344484-117344506 AAGCCAGGTAGCTTACCAAGTGG - Intronic
1060589877 9:124810040-124810062 CGGCGGGGTAGATGACCCACAGG - Exonic
1186044885 X:5524913-5524935 AGGCCAGGCTGAGGACCACCTGG + Intergenic
1189623018 X:42863951-42863973 AGGATGGGAAGATGACCAACAGG + Intergenic
1198213953 X:134539427-134539449 GGGCCAGGTACGTGACCAAATGG + Intergenic
1199819149 X:151427432-151427454 AGTCCAGGAAGAAGACCAAAAGG + Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1201929640 Y:19328273-19328295 AGGTTAGGTCCATGACCAACAGG - Intergenic