ID: 1015384863

View in Genome Browser
Species Human (GRCh38)
Location 6:132610486-132610508
Sequence CCAGTTTTTGCTCTTTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015384863_1015384867 -4 Left 1015384863 6:132610486-132610508 CCCCAAGAAAGAGCAAAAACTGG No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015384863 Original CRISPR CCAGTTTTTGCTCTTTCTTG GGG (reversed) Intergenic
No off target data available for this crispr