ID: 1015384867

View in Genome Browser
Species Human (GRCh38)
Location 6:132610505-132610527
Sequence CTGGCCCCTTCCTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015384863_1015384867 -4 Left 1015384863 6:132610486-132610508 CCCCAAGAAAGAGCAAAAACTGG No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data
1015384861_1015384867 20 Left 1015384861 6:132610462-132610484 CCTAAGAAAGAGCACAGAAATAA No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data
1015384866_1015384867 -6 Left 1015384866 6:132610488-132610510 CCAAGAAAGAGCAAAAACTGGCC No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data
1015384862_1015384867 -3 Left 1015384862 6:132610485-132610507 CCCCCAAGAAAGAGCAAAAACTG No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data
1015384865_1015384867 -5 Left 1015384865 6:132610487-132610509 CCCAAGAAAGAGCAAAAACTGGC No data
Right 1015384867 6:132610505-132610527 CTGGCCCCTTCCTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015384867 Original CRISPR CTGGCCCCTTCCTCATCTCA AGG Intergenic
No off target data available for this crispr