ID: 1015386580

View in Genome Browser
Species Human (GRCh38)
Location 6:132631620-132631642
Sequence CAGCCCTGGTTGGCTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015386576_1015386580 -1 Left 1015386576 6:132631598-132631620 CCATTCAACTAACATCACTCCTC No data
Right 1015386580 6:132631620-132631642 CAGCCCTGGTTGGCTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015386580 Original CRISPR CAGCCCTGGTTGGCTGATAC AGG Intergenic
No off target data available for this crispr