ID: 1015389726

View in Genome Browser
Species Human (GRCh38)
Location 6:132668004-132668026
Sequence ATGTCTCCACATGTGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015389722_1015389726 25 Left 1015389722 6:132667956-132667978 CCATTAAAAGTACACAGGCAAAT No data
Right 1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG No data
1015389724_1015389726 -9 Left 1015389724 6:132667990-132668012 CCATACATAAAGAAATGTCTCCA No data
Right 1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015389726 Original CRISPR ATGTCTCCACATGTGGAATT TGG Intergenic
No off target data available for this crispr