ID: 1015390715

View in Genome Browser
Species Human (GRCh38)
Location 6:132678446-132678468
Sequence GGGTCTGGTGGGAGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015390715_1015390730 20 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390730 6:132678489-132678511 TACAATTCAACATGAGATTTGGG 0: 1082
1: 9563
2: 12407
3: 9144
4: 6222
1015390715_1015390729 19 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390729 6:132678488-132678510 TTACAATTCAACATGAGATTTGG 0: 1153
1: 5215
2: 13427
3: 13898
4: 10587
1015390715_1015390721 -7 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390721 6:132678462-132678484 CAGACCCCCACCTCCAGCATCGG No data
1015390715_1015390731 23 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390731 6:132678492-132678514 AATTCAACATGAGATTTGGGTGG 0: 949
1: 10039
2: 14142
3: 11560
4: 8529
1015390715_1015390732 24 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390732 6:132678493-132678515 ATTCAACATGAGATTTGGGTGGG 0: 887
1: 10038
2: 13017
3: 11875
4: 8701
1015390715_1015390722 -6 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390722 6:132678463-132678485 AGACCCCCACCTCCAGCATCGGG No data
1015390715_1015390733 25 Left 1015390715 6:132678446-132678468 CCCAGATGCCTCCCACCAGACCC No data
Right 1015390733 6:132678494-132678516 TTCAACATGAGATTTGGGTGGGG 0: 1001
1: 9794
2: 12757
3: 9934
4: 6663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015390715 Original CRISPR GGGTCTGGTGGGAGGCATCT GGG (reversed) Intergenic
No off target data available for this crispr