ID: 1015392768

View in Genome Browser
Species Human (GRCh38)
Location 6:132701780-132701802
Sequence AGGATGGGGGAGAGTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 379}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392768_1015392783 22 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392768_1015392781 20 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392768_1015392777 -2 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392777 6:132701801-132701823 CTCCAGGTTACCACATGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 131
1015392768_1015392780 19 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392768_1015392782 21 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392768_1015392784 26 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392768_1015392775 -7 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392775 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392768 Original CRISPR AGGATGGGGGAGAGTGGTAT TGG (reversed) Intronic
901286399 1:8082673-8082695 AGGAGGGAGGAGAGTGATTTAGG + Intergenic
901671714 1:10860091-10860113 AGGGTGGGGGAGTGTGGGCTGGG - Intergenic
901790983 1:11653713-11653735 GGGATGGGGGTGAGGGGTCTTGG + Intronic
902681521 1:18047273-18047295 AGGATGGAAGAGAGTGGGAGAGG - Intergenic
903450035 1:23446923-23446945 AGGGTGGGGGAGGGTGGTTTTGG + Intronic
905658928 1:39705509-39705531 AGGATTGGGTAGAGTGGGAGGGG - Intronic
905888998 1:41508118-41508140 AGGGTGGGGTGGAGTGGTGTGGG + Exonic
906516206 1:46440276-46440298 AGGTTGGGAGAGGCTGGTATGGG + Intergenic
907265302 1:53255924-53255946 AAGAGGGTGGAGAGTGGGATGGG + Intronic
907316561 1:53576233-53576255 AGGATGGAGGAGAGAGGATTTGG - Intronic
907871706 1:58449464-58449486 AGGATGGGTGAGAATAGGATAGG + Intronic
908423972 1:63986934-63986956 ATGATGGGGGATTGTGGCATGGG + Intronic
909723517 1:78806109-78806131 AGGCTGGTGGAGAGAGGTAATGG - Intergenic
911314485 1:96339570-96339592 AGGAAGGTGGAGAGTTCTATGGG - Intergenic
911995189 1:104758025-104758047 GGGATGGGGAAGAGGGGGATGGG + Intergenic
912549192 1:110473630-110473652 AGGTTGGGGGGGAGTTGTCTGGG + Intergenic
913041894 1:115035002-115035024 GGGATGGGGGAGAGTGCAAAGGG + Intergenic
913181956 1:116330749-116330771 AGGGTGGGAGGGAGTGGGATAGG + Intergenic
913448706 1:118976861-118976883 AGAATGGGGGAGAGGGGCAATGG + Intronic
914397595 1:147285742-147285764 AGGCTGGAGTACAGTGGTATGGG + Intronic
916047804 1:161013734-161013756 AGGATGGCAGAAAGTGGTAATGG + Intronic
916128014 1:161588596-161588618 AGGAAGGAGGAGAGTGGAAGAGG - Intronic
916137932 1:161670426-161670448 AGGAAGGAGGAGAGTGGAAGAGG - Intronic
916578742 1:166089426-166089448 AGGATGGAGGAGAGTGGGAAGGG + Intronic
916863674 1:168833607-168833629 GGGAAGGGGCAGAGTGGTATTGG - Intergenic
917073428 1:171177997-171178019 AGAATGGGGTAGAATGATATTGG + Intergenic
918550162 1:185733726-185733748 AGGAGGGGCGAGAGAGGTGTGGG - Intergenic
918667800 1:187173347-187173369 AGGCTGGGGGAAAGGGGTAATGG - Intergenic
918837542 1:189487226-189487248 AGCATGGGGGATAATGGTATTGG - Intergenic
919246890 1:194999631-194999653 AGGAATGGGGAAGGTGGTATGGG + Intergenic
919283708 1:195525990-195526012 AGATTGGGGAAGGGTGGTATAGG - Intergenic
919601577 1:199629509-199629531 AAGAGAGGGGAGAGTGGTCTAGG - Intergenic
919935150 1:202246149-202246171 GGGATGGGGGAGGGAGGGATGGG - Intronic
919959792 1:202455138-202455160 AGAATGAGGGAGAGAGGTCTAGG + Intronic
920453468 1:206078757-206078779 AGGAAGGGGAAGGGTGGTAGAGG + Intronic
920593935 1:207249886-207249908 GGGATAGGGGAGACTGGGATGGG + Intergenic
921895051 1:220391105-220391127 AGGATGGAGAAGAGTGGACTGGG + Intergenic
922443968 1:225680632-225680654 AAGTTGGGGGAGAGGGGAATGGG + Intergenic
923356560 1:233161562-233161584 GGGCTGGGGGAGAGTGGTGGGGG + Intronic
923482456 1:234397474-234397496 AGGATGGGGAAGAGGGGGAGGGG + Intronic
924279053 1:242417769-242417791 AGTACGGGGGATGGTGGTATGGG + Intronic
924811664 1:247408232-247408254 GGGATTGGGGAGAGAGGAATGGG - Intergenic
924951997 1:248893371-248893393 GAGATGGGGGAGAGGGATATGGG - Intergenic
1062775674 10:144919-144941 AGAATGGGGAAGAGTGGAAGAGG - Intronic
1064858840 10:19802699-19802721 GGGATGGGGGAATGTGGAATGGG + Intergenic
1064933311 10:20651616-20651638 CGTATGGGGTGGAGTGGTATGGG - Intergenic
1065794784 10:29296119-29296141 AAGAGGGAGGAGAGGGGTATTGG - Intronic
1068425280 10:56853181-56853203 AGGATGGTGGAGAGATGTGTGGG - Intergenic
1068728325 10:60327577-60327599 AGGATATGGGAGAGTGCTATGGG + Intronic
1069220079 10:65872322-65872344 GGGTTGGGGGAGGGTGGAATTGG - Intergenic
1069314198 10:67077427-67077449 AGGATGGGGGAGTGGGGCAAAGG - Intronic
1069755457 10:70772001-70772023 TGGGTGGGGGACAGTGGTAAGGG - Intronic
1069763281 10:70831385-70831407 GGGTTGGGGGAGACAGGTATGGG - Intronic
1070703161 10:78618063-78618085 AGGAAGGAGAAGAGTGGTTTGGG + Intergenic
1071308575 10:84322256-84322278 GGGCTGGGGGAGAGGGGAATGGG + Intergenic
1071836450 10:89422900-89422922 AGAATGGGGAAGAGAGGTAAGGG + Intergenic
1072300523 10:94056781-94056803 AGGATGGGGGTGACTGCTAATGG - Intronic
1073049011 10:100656094-100656116 GGGATGGGGGAGAGGAGAATGGG - Intergenic
1073149700 10:101303369-101303391 ATGATGGGGGAGGGTGGCAGTGG + Intergenic
1073586204 10:104712516-104712538 AGGTTGGGGGAGAGCTGTAGAGG + Intronic
1074529670 10:114288611-114288633 AGGAAGGGGGAGAGGGGAAGTGG + Intronic
1075204111 10:120432011-120432033 GGGATAGGGCAGGGTGGTATTGG - Intergenic
1075975672 10:126691879-126691901 AGGGTGGGGCAGAGTGGTTTTGG + Intergenic
1076169264 10:128306199-128306221 ATGATGGGGGAGAGTGCCTTGGG + Intergenic
1077063103 11:626347-626369 AGGATGGGGGAGAGGGGGAGGGG - Intergenic
1077332182 11:1988572-1988594 GGGATGGGGGAGAGGGGCACAGG + Intergenic
1078086671 11:8237639-8237661 AGGATGAGGGAGAGAGGCAGGGG + Intronic
1079871973 11:25808988-25809010 AGGAAGGGGGAGATGGGAATGGG + Intergenic
1080649217 11:34209584-34209606 AGGATGGGGGTGAGGGGGAGGGG + Intronic
1080649349 11:34209860-34209882 GGGATGGGGGTGAGGGGTAGTGG + Intronic
1081419781 11:42862180-42862202 AGGAATGGAGAGGGTGGTATTGG - Intergenic
1081534707 11:43988261-43988283 AGGGTAAGGGAGAGTGGTGTGGG - Intergenic
1083275481 11:61594737-61594759 AGGACGGGGGAGGGTGGGGTGGG + Intergenic
1083852557 11:65376776-65376798 AGGATGGGGGACAGAGGTGTGGG - Intronic
1084203281 11:67576465-67576487 AGGATGATGGAGAGTGGGACAGG - Intergenic
1084551390 11:69845094-69845116 AGGAAGGGGGAGACAGATATGGG - Intergenic
1085070761 11:73542747-73542769 AGCAAGGAGGAGAGTGCTATGGG - Intronic
1085519346 11:77129102-77129124 GGGATGGGGGAGAGTGGTGAGGG - Intronic
1086129738 11:83388829-83388851 AGTAGGAGGGAGAGTGGGATAGG + Intergenic
1086277383 11:85147084-85147106 CGGTTGGGGAAGGGTGGTATAGG + Intronic
1086541541 11:87917911-87917933 AGAAAGGGGGAGATTGGTAAGGG + Intergenic
1086877803 11:92118394-92118416 AGAATGGGGAAGAGTGGGAGGGG + Intergenic
1087605869 11:100377012-100377034 AGGATGGGGGAGAGGGGGAGAGG + Intergenic
1088075050 11:105837590-105837612 AGGAAGGGGGAGAGTAGATTTGG + Intronic
1088330624 11:108647520-108647542 GGGATCGAGGAGGGTGGTATAGG - Intergenic
1089007425 11:115104015-115104037 AGGATGAGGCAGTGTGGTACGGG - Intergenic
1090266476 11:125356515-125356537 AGGATCGGGGTGAGGGGAATGGG - Intronic
1202815163 11_KI270721v1_random:43748-43770 GGGATGGGGGAGAGGGGCACAGG + Intergenic
1091623196 12:2105449-2105471 AGGATGGGGGAGAGGAGGACCGG + Intronic
1092791726 12:12076214-12076236 TGCATGGGGGAGGGTGGGATTGG + Intronic
1092971920 12:13704312-13704334 AGGATGGAGGAGAAGGGCATGGG + Intronic
1094005844 12:25750310-25750332 AGGAAGGGGGTGAGAGGGATTGG + Intergenic
1094183554 12:27616858-27616880 AGGTTAGGGGAGAGTTTTATAGG + Intronic
1094559901 12:31542376-31542398 AGGATGGGGGAAAGTGGGAATGG + Intronic
1094784054 12:33825161-33825183 AGGAAGGGGGAAAATGGCATGGG - Intergenic
1096229214 12:49888167-49888189 AGGATGGGGAGGAGTGTTACAGG - Intronic
1096240404 12:49956761-49956783 AGGACTGGGGAGAGTGAGATGGG - Exonic
1097022161 12:56028085-56028107 AGGATGGGTGAGAGAGGCAGGGG - Intronic
1097845877 12:64364851-64364873 AGGCGGGGTGAGAGTGGTCTAGG - Intronic
1098502716 12:71212169-71212191 AGGATGGGGGAGAAAGATAGGGG + Intronic
1098862714 12:75728067-75728089 AGGATGGGGGAGGCAGGTAAGGG - Intergenic
1100384979 12:94097676-94097698 AGGGTGGAGGAGAGAGGAATGGG - Intergenic
1100981949 12:100168899-100168921 AGCATGGGGGAAGGTGGGATGGG - Intergenic
1103248708 12:119481168-119481190 AGGTAGGGGGACAGTGGGATGGG - Intronic
1104254159 12:127124196-127124218 AGGGTGGGGGATAGAGGTAGGGG + Intergenic
1104254266 12:127124453-127124475 AGGGTGGGGGATAGAGGTAGGGG + Intergenic
1105261015 13:18779516-18779538 AGAATGGGGGTGCATGGTATGGG - Intergenic
1105263321 13:18796107-18796129 AGAATGGGGGTGCATGGTATGGG - Intergenic
1106214725 13:27685835-27685857 TGGAGGGGGGACAGTGGTTTTGG - Intergenic
1106945677 13:34824953-34824975 GGGCTGGGGGAGAGGGGAATGGG - Intergenic
1108467263 13:50728886-50728908 AGGAGGGGAGACAGTGGTAAAGG - Intronic
1110701111 13:78550206-78550228 ATAATGGGGGAGATTGGTGTGGG + Intergenic
1111041419 13:82754118-82754140 AGGAAGGGGGAGTGTGGAGTGGG + Intergenic
1111083705 13:83344947-83344969 AGGATGGGGGAAAGTGGGGATGG + Intergenic
1112503665 13:99960407-99960429 AGGGTGGGGGAGAGGGGCAGGGG - Intergenic
1112775798 13:102843068-102843090 AGGAGGGGTGGGAGTGTTATTGG - Intronic
1113422456 13:110181249-110181271 AGGATGGGGGAGAAGGGTCATGG + Intronic
1113525557 13:110972078-110972100 AGGGTGGGAGAGAGTGGAAAGGG - Intergenic
1113699772 13:112375817-112375839 AGGGTGGGGGAGGGTGGGAGGGG + Intergenic
1113768262 13:112894123-112894145 AGGAGGGGGAAGAGGGGGATGGG + Intergenic
1114551939 14:23537772-23537794 ATGGTGGGGGAGAGGGGTAAGGG + Intronic
1117763936 14:59060620-59060642 AGAATGGTGGAGAGTGGAACTGG + Intergenic
1119611262 14:76064545-76064567 GGCATGAGGGAGAGTGGTAATGG + Intronic
1120638766 14:86984230-86984252 AGGCTGGGAGATGGTGGTATGGG + Intergenic
1121813043 14:96908194-96908216 AGGATCTGAGAGAGTGGAATGGG - Intronic
1121841392 14:97137106-97137128 AGGCTGGGGGAGAGGGGAATGGG - Intergenic
1122903161 14:104790273-104790295 AGGCTGGGGGGGAGTGGAACAGG + Intronic
1123469081 15:20536789-20536811 AGGATGGGGGAAGGTGGAATGGG - Intronic
1123648980 15:22463902-22463924 AGGATGGGGGAAGGTGGAATGGG + Intronic
1123682344 15:22771667-22771689 AGGATGGGGGAAGGTGGGATGGG - Intergenic
1123729356 15:23131777-23131799 AGGATGGGGGAAGGTGGAATGGG - Intronic
1123747524 15:23329259-23329281 AGGATGGGGGAAGGTGGAATGGG - Intergenic
1123762318 15:23442425-23442447 AGGATGGGGGAAGGTGGGATGGG - Intronic
1124279885 15:28353111-28353133 AGGATGGGGGAAGGTGGAATGGG - Intergenic
1124302813 15:28558493-28558515 AGGATGGGGGAAGGTGGAATGGG + Intergenic
1124322148 15:28722493-28722515 ATGGTGGGGGAGAGAGGTACAGG + Intronic
1124334093 15:28844180-28844202 AGGATAGGGGAGGGGGGGATGGG - Intergenic
1124531914 15:30516143-30516165 AGGATGGGGGAAGGTGGAATGGG + Intergenic
1124535417 15:30541881-30541903 ATGGTGGGGGAGAGAGGTACAGG - Intergenic
1124766739 15:32491502-32491524 AGGATGGGGGAAGGTGGAATGGG - Intergenic
1124775390 15:32583344-32583366 ATGGTGGGGGAGAGAGGTACAGG - Intergenic
1124949531 15:34304064-34304086 AGGGTTGGGGAGAGTGAGATGGG - Intronic
1126207399 15:46060951-46060973 AGGGAGGGGGAGAGTGGGAGGGG - Intergenic
1126369128 15:47927130-47927152 AGGATGGGGGAGGCTGTTTTCGG + Intergenic
1127157620 15:56145742-56145764 AAGATGGGGCAGAGTGTTAGAGG - Intronic
1127773545 15:62248846-62248868 AGGACGGGGGAGGGTGGGATGGG - Intergenic
1127775068 15:62258031-62258053 AGGATGGGGGAGGGTGGGATGGG - Intergenic
1128379345 15:67100357-67100379 GGGATGGAGGAGAGGGGAATGGG + Intronic
1128611007 15:69073679-69073701 AGGGTGGAGGAAAGTGGAATGGG + Intergenic
1129893176 15:79085344-79085366 AGGAAGGAGGAGAGTGGGATGGG + Intronic
1130127351 15:81105118-81105140 GGGAGGGGGGAGAAAGGTATGGG - Intronic
1130570812 15:85041820-85041842 AGGATGGGGGACATTAGGATGGG - Intronic
1130884392 15:88081275-88081297 AGGATGGGGTGGAGTGGGACAGG + Intronic
1132155301 15:99491923-99491945 AGGAAGGGCGTGAGTGGTGTGGG + Intergenic
1132320807 15:100923828-100923850 TGGCTGGGGGAGAGTGCTACAGG - Intronic
1132853268 16:2034256-2034278 AGGAGGTGGGAGCGTGATATGGG - Intronic
1133321376 16:4915677-4915699 ACGATGGTGGAGATTGTTATTGG - Intronic
1133807932 16:9139262-9139284 TGGATGGGGGAAAGCGGCATCGG + Intergenic
1134101606 16:11456467-11456489 AGCAAGGGGGAGAGTGGGGTGGG + Intronic
1134316959 16:13127415-13127437 AGGAGGAGGGAGAGAGGGATAGG + Intronic
1135535915 16:23294433-23294455 AGCTTGGGGGAGAGTCTTATAGG - Intronic
1135903649 16:26490253-26490275 AGTATGGGAGAGAATGGAATAGG - Intergenic
1136378184 16:29877516-29877538 AGGATGGGGCAGAGCTGGATGGG - Intronic
1137024511 16:35459359-35459381 AGGAAGGGGCAGGGTGGTGTAGG + Intergenic
1137951601 16:52789104-52789126 AGGATAGGTGAGAGTGGGAAAGG + Intergenic
1137964725 16:52919208-52919230 AGGATGAGGAGGAGTGGTAGAGG + Intergenic
1138576989 16:57914337-57914359 AGGAAGGGGGAAAGTGGAATTGG - Intronic
1139307427 16:65999056-65999078 AGGAAGGTGGAGATTGGGATGGG + Intergenic
1139317691 16:66087439-66087461 GGGATGGGGTAGAGTGGGATGGG + Intergenic
1139428118 16:66895710-66895732 AGGATGGGGGTCAGAGGCATGGG - Intronic
1140668682 16:77252367-77252389 AGGCTGGGGGAAGGTGGAATGGG - Intronic
1143153552 17:4821922-4821944 GGGGTGGGGGAGAGTGGCCTGGG + Intronic
1143853311 17:9829172-9829194 AGTGTGGGAGAGAGTGGTGTGGG - Intronic
1144452297 17:15391151-15391173 AGGAAGGCGGAGATAGGTATGGG - Intergenic
1144789995 17:17852316-17852338 ATGGTGGGGGAGGGTGGTTTGGG + Intronic
1145058930 17:19720330-19720352 AGGATGAGGCAGAGGGGCATGGG - Intergenic
1148361582 17:47016930-47016952 AGGGTGGGGTAGGGTGGGATGGG - Intronic
1149153297 17:53595011-53595033 GGGGTGGGGGAGGGTGGTGTTGG + Intergenic
1149725989 17:58895227-58895249 AGGAAAGGGGAGAGAGGGATGGG - Intronic
1149867359 17:60158135-60158157 AGGATGGGGGAGAAGGGCTTGGG + Intronic
1150405560 17:64897498-64897520 AGGGTGGGGTAGGGTGGGATGGG + Exonic
1150605828 17:66690053-66690075 GGGGTGGGGAAGAGTGGTCTTGG + Intronic
1150935828 17:69634348-69634370 GGGTTGGGGGAGAATGGAATTGG + Intergenic
1151320658 17:73350426-73350448 AGCCAGGTGGAGAGTGGTATGGG - Intronic
1151581532 17:74982014-74982036 TGCATGGGGGAGAGGGGGATGGG + Intergenic
1151714326 17:75823709-75823731 AGGCTGGGGGTGAGGGGTGTCGG + Intronic
1153088498 18:1317580-1317602 AGGATTGGGAAGGATGGTATAGG - Intergenic
1153700038 18:7683546-7683568 TGGATGTGGGAGATTGGCATAGG + Intronic
1155056912 18:22193030-22193052 AGAAGGGGCGAGAGGGGTATGGG + Intronic
1155438090 18:25833755-25833777 GGGATGGGGGAGAAGGGGATGGG + Intergenic
1156267804 18:35504031-35504053 AGGTGGAGGGAGAGTGGTAGAGG + Intergenic
1157994145 18:52534991-52535013 GAGATGGGGGAAAGTGGTAAAGG - Intronic
1158599344 18:58843768-58843790 AGGGTGTGGGAGAGTGGCAGGGG - Intergenic
1160208095 18:76853588-76853610 AGGCTGGGGGATAGGGGGATTGG + Intronic
1160240224 18:77117986-77118008 GGGATGGGGGACAGTGGGTTGGG + Intronic
1160240285 18:77118131-77118153 GGGATGGGGGACAGTGGGTTGGG + Intronic
1160240306 18:77118180-77118202 GGGATGGGGGACAGTGGGTTGGG + Intronic
1160433820 18:78831059-78831081 AGGATGGGGCAGAGAGGTCATGG - Intergenic
1160821810 19:1062452-1062474 AGGATGGGGGACAGAGGTATAGG - Intronic
1161526703 19:4760354-4760376 GGGATGGGGGAGGGGGGGATTGG - Intergenic
1161610484 19:5239230-5239252 GGGATGAGGGAGAGAGGTAGAGG + Intronic
1162032203 19:7922415-7922437 TGGATGGAGGAGAGGGGTAAGGG - Intronic
1162550964 19:11357908-11357930 TGGATGGGGCAGAGAGGGATTGG - Intronic
1163491714 19:17620639-17620661 GGGGTGGGGGGGAGTGGGATGGG + Intronic
1163642673 19:18470357-18470379 AGGTTGGGGTAGAGGGGCATGGG + Intronic
1165764685 19:38343380-38343402 AGGAGGGGGCAGAGGGGTAAGGG - Intronic
1166804604 19:45477983-45478005 AGGATGGGGGTGAATATTATGGG - Intronic
1168615582 19:57834387-57834409 GGGATGGGGAGGAGTGGCATTGG + Intronic
1168621202 19:57881060-57881082 GGGATGGGGAGGAGTGGCATTGG - Intronic
925188821 2:1867014-1867036 GGGATGGGGGAGAGAGGGAGAGG + Intronic
925491284 2:4395952-4395974 AAGATAGGGAAGGGTGGTATAGG + Intergenic
925885383 2:8390652-8390674 GGGATGGGGTAGGGTGGGATGGG + Intergenic
925943464 2:8840294-8840316 AGGGTGGGTGGGAGGGGTATGGG - Intergenic
926871113 2:17418289-17418311 AGGATGGGGGAGGGAGAGATAGG + Intergenic
926969406 2:18451955-18451977 AGGAGGAGGAAGTGTGGTATAGG - Intergenic
927249268 2:20983231-20983253 AGGAGGGGGGAGAGTCCTAGGGG + Intergenic
927539930 2:23899967-23899989 AGGCTGGGGTACAGTGGTCTCGG + Intronic
928117915 2:28560979-28561001 AGGATGAGGGAGAGCGAGATCGG - Intronic
928615214 2:33031574-33031596 AGGAAGGGGGAGATTGGCAGGGG + Intronic
929449470 2:42027231-42027253 AGACTGATGGAGAGTGGTATGGG - Intergenic
933040253 2:77455857-77455879 GGAATGGTGGAGAGTGATATCGG - Intronic
934528006 2:95063824-95063846 AGGAAAGGGGAGAGGGGTACAGG - Intergenic
935124395 2:100210630-100210652 AGGCTGGGGGAGAGTGTAGTTGG + Intergenic
935763454 2:106342584-106342606 AGGATGGAGGAGATTGCCATGGG - Intergenic
938587616 2:132707144-132707166 GGGATGGGGAGGAGTGGTGTTGG - Intronic
939289929 2:140181001-140181023 AGGAGGGTGGAGAGAGGCATTGG - Intergenic
939902009 2:147862114-147862136 AGGATGGGAGACAGTGGAAGGGG - Intronic
940623662 2:156146040-156146062 TGGCTGGGCTAGAGTGGTATCGG - Intergenic
942866970 2:180688132-180688154 CGGAAGAGGGAGAATGGTATGGG + Intergenic
943266375 2:185738308-185738330 AGGCAGTGGGAGAGTGGTAAAGG + Intergenic
943844964 2:192634401-192634423 AGGATGGGGGGGATTGGCCTTGG - Intergenic
945494824 2:210497537-210497559 TGGAGTGGGGAGAGAGGTATGGG - Intronic
945613253 2:212032701-212032723 TTGGTGGGGGAGGGTGGTATTGG + Intronic
945686734 2:212980085-212980107 AGGATGGGGTGGAGGGGTGTCGG + Intergenic
945841488 2:214892588-214892610 AGGATGGGGGAGATAGGCAGTGG - Intergenic
946033827 2:216726010-216726032 GGGATGGGAGAGAATGGTTTGGG - Intergenic
946071174 2:217035525-217035547 AGGATGGATGAGGGTGGGATGGG + Intergenic
946285947 2:218702752-218702774 AGGAAGGGGGAAATTGGTAAAGG - Intergenic
946347108 2:219119514-219119536 GGGATGGGGGAGTGGGGGATTGG - Intronic
946462078 2:219877769-219877791 AGCATGGGGGAGAGTAGCCTTGG - Intergenic
947210367 2:227703090-227703112 AGAATGAGGGAGAGTGGAGTGGG - Intronic
947499046 2:230659059-230659081 GGGATGGAGGAGAGTGGTAGAGG - Intergenic
948995513 2:241576293-241576315 AAGATGAGGGAGAGAAGTATAGG - Intergenic
1169071512 20:2735269-2735291 AGGAAGGGGTAGAGTGGGTTTGG - Intronic
1169081428 20:2799761-2799783 AGGATGGGGCAGAGCGGGAGAGG - Intronic
1172018310 20:31893612-31893634 AGGGTGGTGGAGAGTGGGAGTGG - Intronic
1172045037 20:32074254-32074276 AGAATAGGGGAGAGTGGGCTTGG - Intronic
1172890360 20:38260099-38260121 TGGATGGGGAAGAGTGGTGGTGG - Intronic
1173105258 20:40127637-40127659 AGGATGGAGGTGAGAGGTAGAGG - Intergenic
1173437637 20:43047132-43047154 AGGATGGGGGAGAAAGGCAGAGG - Intronic
1177943615 21:27440897-27440919 AGGCTGGGGGTGAGTGCTTTGGG - Intergenic
1180186860 21:46144544-46144566 AGGAGGGGGGAGAGAGGGAGGGG - Intronic
1180605899 22:17058444-17058466 AGGATGGGGGAAACTGGAAAAGG + Intergenic
1181528363 22:23502518-23502540 AGGATGGGGGATGGAGGGATGGG - Intergenic
1181528490 22:23502888-23502910 AGGATGGGGGATGGAGGGATTGG - Intergenic
1181685642 22:24525919-24525941 AGGCAGGGGGAGAGTGGCATGGG + Exonic
1181729702 22:24835755-24835777 GGGATGGGGGAGAGGGGCTTGGG + Intronic
1181763405 22:25073678-25073700 AGAATGGGGCAGAGGGGTGTAGG - Intronic
1182142350 22:27971970-27971992 AAGAGGGGGAAGAGTGGAATTGG + Intergenic
1182944461 22:34308845-34308867 GGGATGGGGTGGAGTGGGATGGG - Intergenic
1182944469 22:34308865-34308887 GGGATGGGGTGGAGTGGGATGGG - Intergenic
1184691115 22:46117733-46117755 TGGAAGGGTGAGGGTGGTATAGG - Intergenic
1185094942 22:48800980-48801002 AGGAGCGGGGAGGGTGGTGTGGG + Intronic
950095754 3:10329269-10329291 AGGATGGGGGAGAGTGAAAAAGG + Intronic
954154857 3:48679770-48679792 AGGATGGAGGGGAGGGGTAATGG - Intronic
954216854 3:49129440-49129462 AGGATGTGGGCCAGTGGTCTGGG - Intronic
955579806 3:60406668-60406690 AGGATGGTGGGGGGTGGTGTGGG + Intronic
955889074 3:63631487-63631509 AGGATGGATCAGGGTGGTATGGG - Intergenic
956472538 3:69582447-69582469 TTGATGGGGCAGAGTGGTTTTGG + Intergenic
956478147 3:69645444-69645466 AGAATGGGGAAGAGTGGAAGGGG + Intergenic
957813160 3:85254761-85254783 AGGTTGGGGGTGAGTGGAAAGGG + Intronic
958803857 3:98786033-98786055 AAGTTGGGGAAGACTGGTATAGG + Intronic
958811817 3:98868600-98868622 AGAAAGGGGGAGGGTGGTAAGGG - Intronic
959294265 3:104515157-104515179 ATGGTGGGGGAGTGTGGTTTTGG - Intergenic
959549669 3:107640411-107640433 AGGATGGAGGAGAGTGTTAAAGG - Intronic
962704539 3:138030248-138030270 AGGGTGGGGGAAAGTGATACTGG + Intronic
962767454 3:138579002-138579024 GGATTGGGGGAGAATGGTATTGG - Intronic
964251998 3:154728531-154728553 AGGAAGGGGGAGGGGGGTGTTGG + Intergenic
965176608 3:165343248-165343270 AGGATGAGGTAGAGTAATATGGG + Intergenic
966164128 3:176998060-176998082 AGTCTGGGGGATAATGGTATGGG - Intergenic
968091711 3:195902083-195902105 AGGGAGGGGGAGAATGGTAGAGG + Intronic
968626375 4:1628271-1628293 GGCATGGGGGAGAGTGGCATGGG + Intronic
968626396 4:1628314-1628336 GGCATGGGGGAGGGTGGCATGGG + Intronic
968626408 4:1628344-1628366 GGCATGGGGGAGGGTGGCATGGG + Intronic
968626450 4:1628450-1628472 GGCATGGGGGAGGGTGGCATGGG + Intronic
968626511 4:1628596-1628618 GGCATGGGGGAGAGTGGCATGGG + Intronic
968626554 4:1628702-1628724 GGCATGGGGGAGGGTGGCATGGG + Intronic
968626604 4:1628808-1628830 GGCATGGGGGAGGGTGGCATGGG + Intronic
969682918 4:8653100-8653122 AGGTAGAGGGAGAGTGGTAAGGG - Intergenic
969711732 4:8848641-8848663 GGGATGGGGGAGCCTGGTTTAGG - Intronic
970204561 4:13643164-13643186 AGGAAGAGGGAGTGTGGTCTGGG - Intergenic
971161401 4:24137492-24137514 GGGGTTGGGGAGAGTGGAATGGG - Intergenic
971975675 4:33683301-33683323 AGAATGGGGGAGGGTGGGAGAGG - Intergenic
972190545 4:36586298-36586320 ATCATGGGGGAGATTGGTTTTGG + Intergenic
973926350 4:55742378-55742400 TGGATGGGGAAGAGTGGGAGGGG + Intergenic
974195245 4:58565815-58565837 AGGATGGGGGAAAGAGAAATAGG + Intergenic
975523742 4:75327350-75327372 AGGATGGGGAAGAGTGGGCAGGG - Intergenic
976139081 4:81971646-81971668 AGGGTGGGGGATGGTGGTAGGGG + Intronic
976269479 4:83216932-83216954 GGGCTGGGGGAGAGGGGAATAGG + Intergenic
980432181 4:132716312-132716334 AGGAATGGGGAAAGTGGTCTAGG - Intergenic
980747634 4:137040293-137040315 AGAATGGGGGAGGGTGGAAAGGG - Intergenic
980996482 4:139784386-139784408 GGGATGAGGGAGAATGGTGTTGG + Intronic
981026120 4:140078531-140078553 AGGATGGGGGAGGGTGGGGCTGG + Intronic
981730537 4:147892567-147892589 AGCATGGGGGAGTGTGGGGTTGG + Intronic
982037978 4:151365309-151365331 AGAATGGGGGAGAGTGGGAAGGG - Intergenic
982392629 4:154882266-154882288 AGGATGGAAGAGAATGGTATTGG - Intergenic
982961302 4:161840886-161840908 AGGAGGAGGGAGAGTGAGATGGG + Intronic
984747127 4:183232423-183232445 AGGATGGAGGAGGGAGGTGTGGG - Intronic
985487337 5:158801-158823 AGGATGGGGCAGAGTGGGGAGGG - Intronic
985566937 5:623651-623673 AGGTTGCGGGAGGGTGGGATTGG + Intronic
986392953 5:7302199-7302221 AGGATGGGGGAGCGGGGGATGGG - Intergenic
986991842 5:13563216-13563238 AGGATAGGGGAGAGTTGAATGGG + Intergenic
988791298 5:34610295-34610317 AGGATGAGGGAGAGAGGGAGAGG - Intergenic
989205351 5:38804372-38804394 AGGATGGAGCAGAGTAGGATTGG - Intergenic
990980492 5:61598474-61598496 AGGGCTGGGGAGAGTGGGATTGG + Intergenic
991132150 5:63134901-63134923 AGGCTGGAGAAGAGTGGTAAAGG + Intergenic
991528244 5:67587627-67587649 GGGATGGGGTAGAGGGGAATGGG + Intergenic
991929088 5:71733971-71733993 AGGCTGGGGGAGTGGGGAATGGG - Intergenic
992427875 5:76676990-76677012 AGGATTGGAGAGAGTGGCAAGGG - Intronic
995634397 5:114169400-114169422 AGAGTGGGAGAGAGTGGTACAGG + Intergenic
998355322 5:141530567-141530589 AGGGTGGGAGAAAGTGGAATTGG - Intronic
999808879 5:155109197-155109219 AGGATGGGGGAAATGGATATAGG + Intergenic
999915679 5:156257128-156257150 AGGCTGGAGTACAGTGGTATGGG - Intronic
1000850249 5:166331031-166331053 AAGATGGGTGACAGTGGAATAGG - Intergenic
1002298065 5:178242135-178242157 AGGAGGGGAGATGGTGGTATTGG + Intronic
1003106516 6:3220704-3220726 AAGACTGGGGAGAGGGGTATGGG + Intergenic
1003119509 6:3308240-3308262 GGGATTGGGGTGAGCGGTATGGG - Intronic
1003646238 6:7915043-7915065 AGCAGAGGGCAGAGTGGTATGGG - Intronic
1005705039 6:28443189-28443211 AGGGTGGGGGAAAGGGGTAGGGG + Intronic
1006340576 6:33444195-33444217 AGAATGGGGGTGACTGGAATAGG + Intronic
1006414246 6:33893926-33893948 AGGATGGGGGAGGGTGGGGAGGG + Intergenic
1007231142 6:40348350-40348372 AGGCCAGGGGAGAGGGGTATGGG + Intergenic
1007765867 6:44159375-44159397 GAGATGGGGGAGAGTGGGCTGGG + Intronic
1009315399 6:62212881-62212903 TGGATGGGGGAGAGAGGGAAGGG + Intronic
1010738404 6:79469097-79469119 AGGATGGGGGAGGGTGTTGCTGG + Intergenic
1012472711 6:99589356-99589378 GGGATGGGGGCGGGTGGGATGGG + Intergenic
1013022980 6:106238457-106238479 AGGAAAGGGGAGAGAGGGATGGG - Intronic
1013726371 6:113102113-113102135 AGGCTGGAGGGCAGTGGTATTGG + Intergenic
1014773623 6:125484551-125484573 AGGAAGAGGGGGAGTGGGATAGG + Intergenic
1015148680 6:130015966-130015988 AGGGTGGAGGAGGGTGGGATGGG + Intronic
1015392768 6:132701780-132701802 AGGATGGGGGAGAGTGGTATTGG - Intronic
1015597767 6:134881891-134881913 AAGAAGGGGGAGTGTGTTATGGG - Intergenic
1015966415 6:138698884-138698906 AGGATTGGGCAGAGTGGGCTAGG - Intergenic
1016096898 6:140049324-140049346 AGGGTGGGGGAGAATATTATGGG + Intergenic
1016097080 6:140051332-140051354 AGGGTGGGGGAGAGTATTATGGG + Intergenic
1016962776 6:149689258-149689280 ATGAAGGGGGAAAGTGGTATTGG + Intronic
1017249407 6:152263149-152263171 AGGATGTGGGAAGGTAGTATAGG + Intronic
1017590301 6:155972181-155972203 AGGAGTGGGGAGAGTGGCAGGGG + Intergenic
1018258589 6:161947537-161947559 AGGAGGGAGGTGAGTGGTCTGGG - Intronic
1018852900 6:167653928-167653950 AGGAAGTGGGACAGTGGCATGGG - Intergenic
1019051594 6:169188026-169188048 GGGATGGGGGACAGGGGGATGGG - Intergenic
1019790354 7:3008612-3008634 AGGATGGGGGAGAATTGGCTTGG + Intronic
1020011525 7:4808129-4808151 AGGACGGGGGAGAGAGGAAGAGG - Intronic
1021860921 7:24905417-24905439 CGGATGAGGGAGAGTGAGATAGG + Intronic
1021867854 7:24976943-24976965 AAGTTGGGGAAGAGTGGCATGGG - Intronic
1022201831 7:28124454-28124476 AGGATGGTGAAGAGTGGGTTGGG - Intronic
1022622635 7:32000481-32000503 AAGAGGCAGGAGAGTGGTATGGG + Intronic
1023393650 7:39733089-39733111 TGGGTGGGGGAGAGTGGAAGAGG - Intergenic
1024141516 7:46467349-46467371 ACCATGTGGGAGACTGGTATTGG + Intergenic
1025730961 7:64107077-64107099 AGTATAGGGGTAAGTGGTATGGG + Intronic
1026115086 7:67489264-67489286 AGGATGGGACAGGGTGGCATAGG + Intergenic
1027327198 7:77057936-77057958 AGGAGGATGGAGAGTGGTTTGGG - Intergenic
1027953172 7:84846149-84846171 ATGATGGGGGAGATTGTTCTTGG + Intergenic
1029868133 7:103658539-103658561 AGGATAGGGTAGGGTGGCATAGG - Intronic
1030023492 7:105299001-105299023 TGGATGGGGGAGGGTGTTCTGGG - Intronic
1030426666 7:109387204-109387226 AGGATGAGGGAGAGTAGAAGAGG + Intergenic
1030485939 7:110167725-110167747 TGGAAGGGGGAGAGTGGGAGTGG - Intergenic
1030769114 7:113451360-113451382 AGGATGTGGGAGAGTAAGATAGG + Intergenic
1034285096 7:149879138-149879160 AGGATGGGGGAGGGGGGTGCTGG - Intronic
1034852664 7:154509920-154509942 AGAATGGGGGTGAGGGGCATGGG + Intronic
1035112021 7:156491178-156491200 AGGGTGGTGGAGAGTGGTGAGGG - Intergenic
1035447543 7:158952977-158952999 AGGATGGGGGAGCGTGATGCTGG - Intronic
1035730645 8:1851495-1851517 AGGATGGGGGATAGTGTTGGGGG + Intronic
1035748909 8:1981693-1981715 AGGACAGGGGAGAGTGGGAGAGG - Intronic
1037258920 8:16985378-16985400 AGAAGGTGGGAGAGTGGGATGGG + Intergenic
1037369627 8:18162304-18162326 GGGGTGGGGTAGAGTGGTATAGG - Intergenic
1038070923 8:24012296-24012318 AGAAGGGGGGAGTGTGGAATGGG - Intergenic
1038370476 8:26984318-26984340 GGGATGGGGGAGAGGGAAATGGG + Intergenic
1040461341 8:47651949-47651971 TAGATGGGGGAGAGTGGGAGAGG + Intronic
1043719095 8:83522737-83522759 AGGATGTAGGAGAATAGTATTGG + Intergenic
1045845060 8:106624532-106624554 AAGATGGGACAGAGTGGTAGGGG + Intronic
1047212355 8:122850320-122850342 TGAATGGGGGACAGTGGTAGAGG - Intronic
1047249906 8:123174217-123174239 TGGATGGGGGAGTGGGGTCTAGG + Intergenic
1047336338 8:123940226-123940248 AGCATGGGGGAGGGTGGTGGTGG + Intronic
1047345542 8:124024347-124024369 AGAAAGGGGGAGGGTGGGATGGG - Intronic
1048878780 8:138856968-138856990 AGGGTGGGGGAGAGTGGGATGGG - Intronic
1049123364 8:140760565-140760587 AGGCTGGGGAAGGGTGGAATGGG + Intronic
1049564798 8:143332404-143332426 AGGATGGGGGAGAGTGAGATGGG + Intronic
1049610506 8:143552883-143552905 AGGGTGGGGCAGAGTGGGAAAGG + Intergenic
1049754086 8:144300873-144300895 ATGATGGGGGACACTGGTGTAGG + Intronic
1050265003 9:3880688-3880710 AGGTTGGGGAAAAGTGGTACTGG - Intronic
1051615909 9:19006605-19006627 AGGATGGGAGGGAGGGGTAATGG + Intronic
1051927098 9:22341786-22341808 AGGATTGGGGTGAGTATTATTGG + Intergenic
1053240274 9:36488975-36488997 AGGTTGGGGGAAAGTGGACTGGG + Intergenic
1054734316 9:68735196-68735218 AAGATAGGGGAAACTGGTATGGG - Intronic
1054804298 9:69383316-69383338 GGGATGGGGGAGAAGGGAATGGG - Intronic
1056073147 9:83009839-83009861 TGGAAGGGTGAGAGTGGTGTGGG - Intronic
1056516648 9:87358731-87358753 AGGATGGGGGAGGGGGGCATTGG - Intergenic
1056560881 9:87728035-87728057 AGGATGGAGGAGAGCAGTGTGGG + Exonic
1056574514 9:87844588-87844610 AGGATGGAGGAGAGCAGTGTGGG + Intergenic
1057134582 9:92678582-92678604 AGGCTGGGGGAGGGAGGAATGGG + Intergenic
1057664865 9:97037585-97037607 AGGATGGAGGAGAGCAGTGTGGG - Exonic
1057811573 9:98261206-98261228 AGGCTGGGGGAGGGAGGAATGGG + Intergenic
1057966808 9:99512297-99512319 GGGTTGGGGGAAGGTGGTATTGG - Intergenic
1058186778 9:101864371-101864393 AGGGTTGGGGAGAGTGGCAAAGG - Intergenic
1058806918 9:108601819-108601841 AGGAAGGGGGAAAGTGAAATTGG + Intergenic
1059018080 9:110543786-110543808 AGGATGGGGGAGTAAGGAATAGG + Intronic
1061063498 9:128263009-128263031 AGGATGGGGGATGGTGGGATGGG - Intronic
1061255629 9:129453286-129453308 AGGATGGGGGATGGAGGGATGGG + Intergenic
1061672226 9:132195202-132195224 TGGGTGGGGGAGGGTGGCATGGG - Intronic
1061916183 9:133755662-133755684 AGGGTGGGGGAGAGAGGGAAAGG + Intergenic
1062355683 9:136160926-136160948 AAGATGGGGGAGAGGGGCAGGGG - Intergenic
1186047465 X:5552055-5552077 ATGATGGGCCAGAGTGGTCTTGG - Intergenic
1186373864 X:8977073-8977095 AAGAAGGGGGAGAGTGGGAGAGG - Intergenic
1186483149 X:9911518-9911540 AGGATGTGGGAGGGTGGGATAGG + Intronic
1187155558 X:16717813-16717835 AGGATGGGGGTGGGGGGAATGGG - Intergenic
1187456931 X:19449524-19449546 AGGTGCGGGGGGAGTGGTATTGG + Intronic
1188748974 X:33882340-33882362 GGACTGGGGGAAAGTGGTATGGG - Intergenic
1190319948 X:49174158-49174180 AGGAGGAGGGAGAGTGGGGTAGG + Intronic
1190339161 X:49282709-49282731 AGGGAGGGGGAGAGTGGTGCGGG + Intronic
1195715749 X:107817221-107817243 AGCAAGGGTGAGAGTGGAATAGG + Intergenic
1196528340 X:116753044-116753066 AAAATGGGGGAGAGTGGAAGAGG + Intergenic
1197193868 X:123678799-123678821 AGGATGAGAGAGGGAGGTATTGG - Intronic
1197805777 X:130397286-130397308 GGGATGGGGCAGAGTGGTAATGG - Intergenic
1200174372 X:154102432-154102454 AGGATCGGGGAGAGGAGGATGGG + Intergenic
1201107651 Y:10775209-10775231 AGAATGGAGAAGAGTGGAATGGG - Intergenic
1202575891 Y:26324500-26324522 AGAATGAGGGAGAGAGGTCTAGG - Intergenic