ID: 1015392770

View in Genome Browser
Species Human (GRCh38)
Location 6:132701786-132701808
Sequence ACCTGGAGGATGGGGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 0, 2: 11, 3: 103, 4: 783}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392770_1015392780 13 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392770_1015392783 16 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392770_1015392782 15 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392770_1015392777 -8 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392777 6:132701801-132701823 CTCCAGGTTACCACATGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 131
1015392770_1015392784 20 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392770_1015392781 14 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392770 Original CRISPR ACCTGGAGGATGGGGGAGAG TGG (reversed) Intronic
900066289 1:732826-732848 ACCTCGAGGATGGGAGGCAGGGG + Intergenic
900548125 1:3239919-3239941 GCCTGGAGGCTGGGGGTGGGCGG + Intronic
900628811 1:3623122-3623144 AGAGGGAGAATGGGGGAGAGAGG - Intergenic
900973791 1:6005586-6005608 ACCAGCAGGAGGGGAGAGAGGGG - Intronic
901062380 1:6477796-6477818 AACTTGATGATGTGGGAGAGGGG - Intronic
901186491 1:7376699-7376721 ACATGGAGGATGGTGGAGCTAGG + Intronic
901530401 1:9849218-9849240 TCCTGGAGGCAGGGGGTGAGGGG - Exonic
901656391 1:10772156-10772178 GCCTGGAGGAAGGAGGAGAAGGG + Intronic
901673144 1:10867429-10867451 ACGTGGAGGGTGGGGGAGGAGGG - Intergenic
901842767 1:11964307-11964329 ACCTGCAGGGTGGGGGTGGGTGG + Intronic
902412478 1:16219508-16219530 ACCAGGAGCAGTGGGGAGAGGGG - Intergenic
902578502 1:17393794-17393816 ACCTGAAGAGTAGGGGAGAGAGG + Intronic
903398161 1:23018820-23018842 ACATGAAGGATGGGGGACATGGG + Intergenic
903398169 1:23018836-23018858 ACATGGGGGATGGGGGACATGGG + Intergenic
903691151 1:25174595-25174617 GGCTGGTGGATGGAGGAGAGGGG - Intergenic
903787247 1:25869620-25869642 GGTTGGAGGATGGGGGAGGGAGG + Intronic
904050370 1:27634839-27634861 ACCTGGAGGAGAGGGCGGAGGGG - Intronic
904087073 1:27916750-27916772 AGGAGGAGGAAGGGGGAGAGAGG - Intergenic
904373512 1:30065821-30065843 ACCTGGATGTTGGTGAAGAGTGG - Intergenic
904413519 1:30340498-30340520 ACCTAGAGGATGGTGGAGGATGG + Intergenic
904521759 1:31101281-31101303 AGAGGGAGGAAGGGGGAGAGAGG + Intergenic
904600572 1:31670554-31670576 ACCTGGCTGACGGGGGGGAGGGG + Intronic
905064347 1:35167163-35167185 AGCTGGAGGATGGGGGAAATGGG + Intergenic
905224394 1:36469678-36469700 ACCTGGAGGATGGAACAGAATGG - Exonic
905773413 1:40653002-40653024 ACAGGAAGGATGGGGGTGAGAGG + Intronic
905893472 1:41531089-41531111 AGATGGAGGATGGGAGAGAAGGG + Intronic
906192033 1:43904983-43905005 AGCAGGAGGAGGGGGAAGAGTGG - Intronic
907067350 1:51498736-51498758 ACCAGGTGACTGGGGGAGAGAGG - Intronic
908157530 1:61370039-61370061 ACATGGGGAATTGGGGAGAGAGG + Intronic
908395871 1:63725271-63725293 ACCTGGGGGATGGTGGAGGGTGG - Intergenic
908420230 1:63952195-63952217 ATCTGGAGGAGGTGAGAGAGTGG + Intronic
908472607 1:64458922-64458944 ACCTGGAGTACAGGGCAGAGTGG + Intergenic
908807291 1:67944743-67944765 TGCTGGAAGTTGGGGGAGAGAGG + Intergenic
909151418 1:72010624-72010646 TCCTGGAGGGGGTGGGAGAGTGG - Intronic
910140179 1:84018464-84018486 ACCTGGTGGAGGGGGCAGGGTGG + Intergenic
910149579 1:84126073-84126095 TCCTGGGGGGTGGGGGGGAGGGG + Intronic
910305702 1:85760721-85760743 ACCAGGAGGCTGGAGGAGTGGGG + Intronic
910851253 1:91651660-91651682 CCCTGGTGGACGGGGGAGAGGGG - Intergenic
911610024 1:99950514-99950536 GCCTGGGGGAAGGGGGACAGTGG - Intergenic
911907261 1:103586461-103586483 AGCTGGAGGCTGGGGGAGGAAGG - Intergenic
912535899 1:110370308-110370330 CTCTGGAGGTTGGGGGTGAGTGG - Intronic
912562005 1:110557670-110557692 ATCTGTGGGATGGGGCAGAGGGG + Intergenic
913263878 1:117025689-117025711 TGCTGGAGTATGGGGAAGAGGGG + Exonic
913452160 1:118999800-118999822 ATCTGGAGGAGTGGGGAGATGGG + Intergenic
914806491 1:150995804-150995826 TCCTGGAGAATGAGGGTGAGGGG - Intergenic
915519317 1:156432158-156432180 CCCTGGAGGAGGGGGCTGAGGGG + Intergenic
915580477 1:156809891-156809913 AAGTGGAGGATGGGGGAAGGGGG + Intronic
915635444 1:157183265-157183287 AGCCAGAGGATGGGGGAGGGAGG - Intergenic
915648600 1:157291555-157291577 AGCCAGAGGATGGGGGAGGGAGG + Intergenic
915950531 1:160187201-160187223 AAATGGAAGGTGGGGGAGAGAGG + Intergenic
916811227 1:168307376-168307398 ACATGGATGGTGGGGGAAAGAGG + Intronic
918519806 1:185403596-185403618 ATCTGGAGTTTAGGGGAGAGGGG + Intergenic
918550164 1:185733732-185733754 ACAAGGAGGAGGGGCGAGAGAGG - Intergenic
918570804 1:185989559-185989581 ACCTGGAGGAGAGGAGAGTGGGG + Exonic
918782264 1:188715937-188715959 ACCTGGAGGAATGGGGGGAGAGG + Intergenic
919466074 1:197922512-197922534 ACCTGGAGGATGGGGAGTGGGGG - Intronic
919584205 1:199416062-199416084 AGCTGGAGGAAGAGAGAGAGGGG - Intergenic
919831013 1:201539961-201539983 TCCCGGAGGAGAGGGGAGAGAGG + Intergenic
919896184 1:202011108-202011130 ACCTGTGGGTAGGGGGAGAGAGG - Exonic
920005744 1:202832582-202832604 GTCTGGGGGATGGTGGAGAGTGG + Intergenic
920202317 1:204267169-204267191 TCCTGGAGGAATGGGGAGAGAGG - Intronic
920261247 1:204689417-204689439 ACTTGCAGGATGGTGGGGAGAGG + Intergenic
920967021 1:210709362-210709384 ACCAGCAGGAGGTGGGAGAGAGG + Intronic
921053404 1:211526907-211526929 ACTAGGAGGATGGGGTGGAGGGG - Intergenic
921290152 1:213649587-213649609 ACCTGGTGGGCGGGGGAGGGAGG - Intergenic
922918213 1:229276249-229276271 ACTTGGAGGGTGAGGGAGATCGG + Intronic
923193149 1:231640198-231640220 AAGTGGAGGAGGAGGGAGAGAGG - Intronic
923620863 1:235577936-235577958 ACCTTGAGGAGGGAAGAGAGAGG - Intronic
923663600 1:235979668-235979690 ACCAGAAGGATAAGGGAGAGGGG + Intronic
923942327 1:238842095-238842117 ACCTAGAGGATGAAGGAGAACGG - Intergenic
924894038 1:248316807-248316829 AGGTGGAGGAGGGGGGCGAGGGG - Intergenic
1062860257 10:805066-805088 ACCTGGGAGACGGGGGAGGGCGG - Intergenic
1062915377 10:1239206-1239228 ACCGGGAGGGAGAGGGAGAGGGG - Intronic
1063848961 10:10162806-10162828 ACACGGATGATGGGGGTGAGGGG + Intergenic
1063952309 10:11234717-11234739 AACTGGTGGGTGGGGGTGAGAGG + Intronic
1064680180 10:17803579-17803601 AGGTGGAGGATGGAGGAGAATGG - Intergenic
1065788968 10:29242375-29242397 AACTGGAGGTTGCGGGAGGGGGG - Intergenic
1065869660 10:29945565-29945587 TTCTGGAGAATGGGGGTGAGGGG - Intergenic
1065961793 10:30739719-30739741 TCCTGAGGGATGGGGGTGAGAGG + Intergenic
1066694862 10:38068731-38068753 TCCTGGAGGAAGGAGAAGAGGGG + Intergenic
1066997649 10:42578451-42578473 TCCTGGAGGAAGGAGAAGAGGGG - Intronic
1067066951 10:43109539-43109561 TCCTGGTGGATTGGTGAGAGTGG + Intronic
1067204238 10:44199822-44199844 ACCTGGAGAGTGAGGGAAAGTGG + Intergenic
1067214013 10:44285515-44285537 CCCTGGAGGTTGGGGGATGGAGG - Intergenic
1067685340 10:48463511-48463533 AGCTGGAGGAAAGGGGAGGGAGG - Intronic
1067773520 10:49144687-49144709 ACCTGGAAAATGGGGAAGAGGGG - Intergenic
1068298168 10:55103024-55103046 AGGTGGAGGATGTGGAAGAGGGG + Intronic
1068825671 10:61435885-61435907 TCCTGTAGGGTGGGGGACAGGGG + Intronic
1068865457 10:61890157-61890179 CCCTGGTGGATGGGGTGGAGGGG + Intergenic
1069020452 10:63481816-63481838 AGCTGGAGGAAGTGGAAGAGAGG + Intergenic
1069603270 10:69723165-69723187 GCCTGGGGGAAGGAGGAGAGGGG + Intergenic
1069872586 10:71542322-71542344 ATATGGAGAATGAGGGAGAGTGG + Intronic
1070152729 10:73814976-73814998 ACCTGGTTGACGGGGGAGAGGGG - Intronic
1070325182 10:75384212-75384234 ACCAGGAGGGAGGGAGAGAGGGG - Intergenic
1070646410 10:78205095-78205117 TCCTGGAGGAAGGTGGAGTGGGG - Intergenic
1070749697 10:78956669-78956691 GCCTGGAGGATGGGAGCGATTGG - Intergenic
1070806316 10:79273063-79273085 CCTTGGGTGATGGGGGAGAGGGG + Intronic
1071500903 10:86203763-86203785 ACCTGGAGGGTGGAGGTGAGCGG - Intronic
1071529218 10:86376641-86376663 GCCTGGTGGTTGGGGGTGAGGGG + Intergenic
1071712984 10:88067872-88067894 ACCATCAGGAAGGGGGAGAGAGG + Intergenic
1072961256 10:99931256-99931278 ACTTGGAGGATGGGGAATGGAGG - Intronic
1073057128 10:100710065-100710087 TCCTGGGGGATGGGGGCGCGGGG - Intergenic
1073313287 10:102559684-102559706 ACCCAGAGGATGGGGGGCAGGGG - Intronic
1074529668 10:114288605-114288627 GCCAGCAGGAAGGGGGAGAGGGG + Intronic
1074546071 10:114403553-114403575 TGCAGGAGGATGGGGGAGGGGGG + Intronic
1075440722 10:122477440-122477462 ACCTGGAGGATGGGGCCCCGAGG + Intronic
1075493689 10:122899154-122899176 AGGGGGAGGATGGGAGAGAGGGG - Intergenic
1075733358 10:124649380-124649402 GAATGGAGGATGGGGTAGAGAGG + Intronic
1075819313 10:125292105-125292127 CCTAGGAGGCTGGGGGAGAGTGG - Intergenic
1076034091 10:127184485-127184507 ACCTGCAGGATGGGGGACGGGGG - Intronic
1076045934 10:127294137-127294159 ACCATGAGGATGGAAGAGAGAGG - Intronic
1076159487 10:128232384-128232406 AGCTGGAGGATGAGAGAAAGAGG - Intergenic
1076327085 10:129632692-129632714 TGCTGGAGTTTGGGGGAGAGAGG + Intronic
1076555200 10:131316867-131316889 ACCTCGATGCTGGGGCAGAGGGG - Intergenic
1076699058 10:132260764-132260786 ACCTGGAGGGGCAGGGAGAGGGG + Intronic
1076715959 10:132363800-132363822 ACCTGGAGGAAGGGTGAGGTGGG + Intronic
1076721552 10:132395562-132395584 ACCTGGAGCAGGGTGGCGAGGGG + Intergenic
1076788013 10:132760713-132760735 ACCTGGGCCATGGGAGAGAGGGG - Intronic
1076945792 10:133648917-133648939 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
1076945823 10:133649053-133649075 CCCTGGAAGAAGGGGCAGAGTGG - Intergenic
1076948504 10:133666773-133666795 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076951462 10:133676681-133676703 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076952452 10:133679991-133680013 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076955408 10:133742952-133742974 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076956398 10:133746262-133746284 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076957386 10:133749571-133749593 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1076959359 10:133756180-133756202 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
1077952581 11:6976709-6976731 AGCTAGAGCATGGGGAAGAGTGG - Intronic
1078086668 11:8237633-8237655 ACTGTGAGGATGAGGGAGAGAGG + Intronic
1078152528 11:8771612-8771634 TCCTGAGGGATGGGGGTGAGAGG + Intronic
1078883620 11:15478206-15478228 ACCAGGAGGATGGAGCAGACGGG - Intergenic
1079099823 11:17534168-17534190 GCCGGGAGGCTGGAGGAGAGAGG - Intronic
1079130767 11:17745669-17745691 CCATGGAGGCTGGGGGAGGGAGG - Intronic
1080192627 11:29570138-29570160 AGCAGGAGGAAGGGAGAGAGAGG + Intergenic
1080519965 11:33060243-33060265 ACCTGGAAGCTGGGGCATAGTGG + Intronic
1081569074 11:44278466-44278488 CCCTTGAGGATGAGGGAGTGAGG + Intronic
1081655770 11:44856467-44856489 TCCTGGAGGAAGGGGAAGATTGG - Intronic
1081756881 11:45551191-45551213 ACTTGGAGGTTTGGGGAGAGAGG - Intergenic
1081785081 11:45740424-45740446 GGCTGGAGGATGGGGGATATGGG - Intergenic
1082171133 11:49007208-49007230 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1083171300 11:60925187-60925209 CCCTGGGGGAAGGGGGAGGGAGG - Intronic
1083335602 11:61920007-61920029 ACCTGGGGCATGGAGGGGAGGGG - Intronic
1083424536 11:62576243-62576265 ACCTGGAGGAGGAGGAAGAGTGG + Exonic
1083570937 11:63762164-63762186 ACCTGAAGGAAGGAGGAGCGAGG - Exonic
1083599609 11:63938831-63938853 ACCAGGAGGAGGCGGGAGCGCGG - Intergenic
1083878320 11:65536320-65536342 AGCTGGAGGAAGTGGGTGAGTGG + Exonic
1084162312 11:67356518-67356540 AGCTGGAGGCAGGTGGAGAGAGG + Intronic
1084584646 11:70050542-70050564 ACCTTGAGGATGGTGGAGGTGGG - Intergenic
1084792601 11:71484066-71484088 AGCTGGAGGAGGAGGGAGTGGGG + Intronic
1084951655 11:72669650-72669672 TCCTGGAGGCTGGGGCAGAGGGG + Intronic
1085318723 11:75561844-75561866 AGCTTGAAAATGGGGGAGAGCGG + Intergenic
1085665856 11:78415660-78415682 ACATGGAAGATGGGAAAGAGAGG + Intronic
1085690393 11:78659529-78659551 ACCTGAAGGATGGGTGGGGGTGG + Intronic
1086694769 11:89829881-89829903 ATCTGGGGGTTGGGGGATAGGGG + Intergenic
1086711379 11:90014616-90014638 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1086899583 11:92352033-92352055 TCCTAGAAGAAGGGGGAGAGTGG - Intergenic
1087017267 11:93566229-93566251 ACCTCTGGGAAGGGGGAGAGAGG - Intergenic
1087261932 11:96021704-96021726 ACGTGCACGATGGGGGAAAGGGG - Intronic
1087605867 11:100377006-100377028 GAGAGGAGGATGGGGGAGAGGGG + Intergenic
1088934619 11:114387101-114387123 AACTGGAGGATGGTCGAGAAAGG + Intergenic
1089266913 11:117270554-117270576 ACCGGGGGGGTGGGGGAGTGGGG - Intronic
1089803762 11:121063785-121063807 ACCTGTTTGTTGGGGGAGAGGGG + Intronic
1090266478 11:125356521-125356543 TGCTGGAGGATCGGGGTGAGGGG - Intronic
1091175599 11:133554758-133554780 CCCTGGAGGATGGGGTGGGGTGG - Intergenic
1091392162 12:132178-132200 ACCTGGAGGAAAGGGGAGGCTGG + Intronic
1091635563 12:2194137-2194159 ACTAGGAGGAGGAGGGAGAGTGG - Intronic
1091818218 12:3455324-3455346 AAGTGGAGGATGAGGGTGAGGGG + Intronic
1091889888 12:4045048-4045070 ACCAGGAGGAAGGGGGAGGAAGG + Intergenic
1092074527 12:5662024-5662046 AGCTTGAGGGTGGGGGAGAAGGG - Intronic
1092225209 12:6744082-6744104 AACTGGAGGATGGGAGAGAGGGG - Intergenic
1092234854 12:6800240-6800262 AGGTGGAGGATGGGGTAGAGGGG + Intronic
1092237260 12:6818301-6818323 ACCCTGGGGTTGGGGGAGAGGGG - Intronic
1092926163 12:13274450-13274472 ACCGGGAGGATGGGGCAAAGTGG + Intergenic
1093492343 12:19719448-19719470 ACATGGAGGATGGATGATAGAGG + Intronic
1093860493 12:24160376-24160398 ACCAGGAGGATAGGGGAGGTTGG + Intergenic
1094105133 12:26803141-26803163 CTCTGGAGGATGGGTGAGTGTGG - Intronic
1094112801 12:26879523-26879545 ATTTGGAGGATGGGGGAGGGTGG - Intergenic
1094739756 12:33275255-33275277 ACCTGGGGAAGGGGGGAGAAGGG - Intergenic
1094753846 12:33443059-33443081 ATCTGGAGGGTCGGGGACAGTGG - Intergenic
1095427473 12:42092602-42092624 AACTGGGGGATGGGGGAGAGAGG + Intronic
1096102406 12:48978019-48978041 ACACTCAGGATGGGGGAGAGAGG + Intergenic
1096183615 12:49564686-49564708 AACTGGAGGTTGGGGGAAAGGGG + Intronic
1096526017 12:52210924-52210946 ACCTGTAGGCAGGTGGAGAGGGG + Intergenic
1096670034 12:53193115-53193137 ACCTGGAGCCTTGGGGAGAAGGG - Exonic
1096753106 12:53775830-53775852 ACCTTCAGGATGAAGGAGAGTGG + Intergenic
1096784365 12:54008772-54008794 ACCTGGAGGAAGGGGAGGGGAGG - Intronic
1096814933 12:54196031-54196053 AGCTGGAGGGTGGGGGTTAGAGG - Intergenic
1096836277 12:54353342-54353364 AAGGGGAGGAAGGGGGAGAGGGG - Intergenic
1097022166 12:56028091-56028113 GCCCAGAGGATGGGTGAGAGAGG - Intronic
1097175394 12:57139406-57139428 CCCTGGAGGGTGGGGGCCAGGGG + Intronic
1097246364 12:57609857-57609879 ACCTGCTGGAAAGGGGAGAGGGG + Intergenic
1097496082 12:60336894-60336916 AGCTGGAGGATGGGAGAAATGGG - Intergenic
1097778573 12:63676411-63676433 ACTGCCAGGATGGGGGAGAGGGG - Intergenic
1098597155 12:72287178-72287200 ACAAGGATGATGGGGGAGGGAGG - Intronic
1099187487 12:79531771-79531793 AACAGGAGCATGGGGGAGAGTGG - Intergenic
1099256970 12:80326155-80326177 ACTTGGAGGAGGGGGCACAGGGG - Intronic
1100247221 12:92771294-92771316 AGCTGAAGAATGGGGTAGAGAGG + Exonic
1100386448 12:94108947-94108969 ACCTGGGGGCTTGGGGAGGGTGG - Intergenic
1100709074 12:97234846-97234868 AGCAGGAGGAAGGGGGAGAGGGG + Intergenic
1101061143 12:100973616-100973638 AACTGTAGGCTGGGGGAGAAGGG - Intronic
1101988263 12:109464102-109464124 CCCTGGAGGTGGTGGGAGAGGGG - Intronic
1102576578 12:113859611-113859633 ACCTGGAGGAGAGGAGAGAAGGG - Intronic
1102748017 12:115267235-115267257 ACCTGGAGGAGGTGGGAGGGTGG + Intergenic
1103399226 12:120631533-120631555 ACCTAGTGCATGGGGGAGGGTGG - Intergenic
1103466231 12:121144037-121144059 ACCAGGAGGAAGTGGGAGTGGGG - Intronic
1103553417 12:121751661-121751683 ACTTGGAGGAAGGGAGGGAGGGG - Intronic
1103754247 12:123190777-123190799 ACCTCTAGGGTGGGGAAGAGAGG + Intronic
1103977319 12:124711681-124711703 CCCTGGAGGATGGGGCACAAGGG + Intergenic
1104215183 12:126727168-126727190 ACTAGGAGGATGGGGGAGCCCGG + Intergenic
1104634008 12:130426606-130426628 ACCTTGTGGATGGGAGAGGGAGG + Intronic
1104634347 12:130428212-130428234 AGCTGGAAGATGGGGGAAGGAGG - Exonic
1104689968 12:130818371-130818393 CTCTGGAGGGTGGGGGGGAGAGG + Intronic
1104903201 12:132200064-132200086 ACAGGGAGGCTGGGGGAGAGGGG + Intronic
1104943142 12:132404191-132404213 ACCTGCAGGCTGGGGGATGGCGG - Intergenic
1105210364 13:18253671-18253693 GCCTGGGGGTGGGGGGAGAGGGG + Intergenic
1105307601 13:19180151-19180173 ACCAGGAGGCTGGAGGAGAGTGG + Intronic
1105438631 13:20398021-20398043 CCTTGGAGGATGGGGCAGAATGG - Intergenic
1106197219 13:27504215-27504237 AGCTGGAGAAGGGGAGAGAGGGG + Intergenic
1106429010 13:29661654-29661676 AGCTGGAGGAAAGAGGAGAGTGG + Intergenic
1106647381 13:31651007-31651029 TCGGAGAGGATGGGGGAGAGAGG - Intergenic
1107182150 13:37473281-37473303 AACTGCAGGGTGGGGGATAGGGG - Intergenic
1107501498 13:40982501-40982523 AACTGGAGAGTGGGGGAGAGAGG - Intronic
1107572805 13:41681095-41681117 ACCTGGGGGATGGTGGAGAATGG - Intronic
1107621194 13:42232281-42232303 ACCTGGAGGATCGGGGCTGGTGG + Intronic
1108437337 13:50413638-50413660 ACCTGGAGAGTCGGGGAGAGGGG + Intronic
1108603021 13:52011390-52011412 ACCTGGTCGGTGGAGGAGAGCGG + Exonic
1108950486 13:56086801-56086823 AGCTGGAGGAAGAGAGAGAGGGG - Intergenic
1110170188 13:72491056-72491078 ATCTGAAGGATAGGGGAGTGGGG + Intergenic
1111051318 13:82885652-82885674 AGCAGGAGGAAGGTGGAGAGAGG + Intergenic
1111929241 13:94496860-94496882 ACCTGGAGCAGAGGAGAGAGAGG + Intergenic
1112143060 13:96667825-96667847 TCCTCTAGGATGGGGGAAAGGGG + Intronic
1113078308 13:106490596-106490618 ACTTTTAGGATGGGGGAGAGGGG - Exonic
1113176552 13:107571468-107571490 ACATGGAGGACCTGGGAGAGTGG + Intronic
1113239049 13:108316107-108316129 ACCTGATGGATGGAGCAGAGCGG - Intergenic
1113436767 13:110298681-110298703 GCCTGGAGGAGGTGGGAGGGAGG + Intronic
1113457984 13:110462415-110462437 ACCTGAAGGATGAAGAAGAGAGG - Intronic
1113525559 13:110972084-110972106 ACTTTGAGGGTGGGAGAGAGTGG - Intergenic
1113628604 13:111864772-111864794 TCCTGGAGGATGTAGGAAAGGGG + Intergenic
1113699768 13:112375811-112375833 ACTTTGAGGGTGGGGGAGGGTGG + Intergenic
1114613010 14:24054337-24054359 AGCTGGAGGAGGGAGCAGAGAGG + Intronic
1114621937 14:24101329-24101351 AGCTGGCGGATGGGAGAGGGTGG + Intronic
1114626100 14:24131418-24131440 AGCTGGCAGGTGGGGGAGAGGGG - Exonic
1115079081 14:29428953-29428975 ACATGGAGGATGGACGAGAGTGG + Intergenic
1115808491 14:37079331-37079353 ACCTTGGGGGTGGGGGTGAGAGG - Intronic
1118369520 14:65125545-65125567 AGCTGGAGCAAGGGAGAGAGGGG + Intergenic
1119215214 14:72864242-72864264 ACCTGCTGGATGGGAGGGAGAGG - Intronic
1119412649 14:74443737-74443759 ACCTGGAGGATGGCTGAAAAGGG + Intergenic
1119472440 14:74908447-74908469 AGCTGGAGGATGGGAGAGAGGGG - Intronic
1119867169 14:77983463-77983485 ATATGGAAGATGAGGGAGAGAGG + Intergenic
1119945537 14:78689854-78689876 AAGAGGAGGAAGGGGGAGAGGGG - Intronic
1121340161 14:93100226-93100248 ACCTGGAGCATGAGGGATGGGGG + Intronic
1121459564 14:94064460-94064482 CCCTGGAGGTTGGTGGGGAGAGG - Intronic
1121641751 14:95489268-95489290 ACCTGTAGGAGATGGGAGAGAGG - Intergenic
1121777030 14:96598006-96598028 AGATGGAGGAGGGGGAAGAGAGG - Intergenic
1121917896 14:97853095-97853117 AGGAGGAGGATGGGGGAAAGAGG - Intergenic
1122029437 14:98901763-98901785 TCCTGGAGGATGGGTGTGATAGG - Intergenic
1122162035 14:99791939-99791961 ACTTGGTGGATGGAGGACAGTGG - Intronic
1122313905 14:100814546-100814568 GGCTGTAGGATGGGGGTGAGAGG + Intergenic
1122445672 14:101766264-101766286 TCCTGGAGTATAGGGTAGAGTGG + Intronic
1122640386 14:103156050-103156072 AACGGGAGGATGTGGGAGGGTGG - Intergenic
1122693035 14:103540247-103540269 ACCTGGAGGCTTGGGGAAAGGGG - Intergenic
1122804479 14:104249713-104249735 ACATGGGGGATGAGGGAGACAGG - Intergenic
1122983998 14:105203847-105203869 ACCTGGGGGTTGGGGGAGCCTGG + Intergenic
1123066250 14:105620951-105620973 CCCAGGAGCATCGGGGAGAGAGG - Intergenic
1123070392 14:105640003-105640025 CCCAGGAGCATCGGGGAGAGAGG - Intergenic
1123074983 14:105663663-105663685 CCCAGGAGCATCGGGGAGAGAGG - Intergenic
1123089628 14:105736791-105736813 CCCAGGAGCATCGGGGAGAGAGG - Intergenic
1123095421 14:105764951-105764973 CCCAGGAGCATCGGGGAGAGAGG - Intergenic
1202834740 14_GL000009v2_random:69326-69348 ATCTGGAGGATGGTGGCGTGGGG + Intergenic
1202919899 14_KI270723v1_random:21510-21532 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
1202919929 14_KI270723v1_random:21646-21668 CCCTGGAAGAAGGGGCAGAGTGG - Intergenic
1202924991 14_KI270724v1_random:15992-16014 CCCTGGAAGAAGGGGCAGAGTGG + Intergenic
1202925021 14_KI270724v1_random:16128-16150 CCCTGGAGGGAGGGGCAGAGCGG + Intergenic
1123492016 15:20788415-20788437 GCCTGTAGGCAGGGGGAGAGAGG + Intergenic
1123548520 15:21357505-21357527 GCCTGTAGGCAGGGGGAGAGAGG + Intergenic
1123908677 15:24945321-24945343 ACATGGTGGGTGGGGGAAAGGGG - Intronic
1124000245 15:25753243-25753265 GGCTGGGGGATGGGGGAGATAGG - Intronic
1124334096 15:28844186-28844208 ACATGTAGGATAGGGGAGGGGGG - Intergenic
1124378383 15:29143365-29143387 ACATGGAGGAGCAGGGAGAGGGG + Intronic
1125328191 15:38558259-38558281 AACTAGAGGATGGTGGAGACCGG - Intronic
1125400002 15:39291923-39291945 ACCAGTAGGAGGAGGGAGAGAGG - Intergenic
1125518043 15:40333860-40333882 ACCAGAAGGAGGGGGCAGAGGGG + Exonic
1125753340 15:42045342-42045364 ACCGGGAGGATGGGGTGGGGTGG + Intronic
1125903468 15:43370227-43370249 ATTTGGAGGAGGTGGGAGAGGGG - Intronic
1126271366 15:46821402-46821424 GCTTGGAGCCTGGGGGAGAGAGG + Intergenic
1126394642 15:48201611-48201633 ACCTTGAGGGTGTGGGAGAGAGG + Exonic
1126675528 15:51156784-51156806 ACCTGGAGGAGGGGGCAGGGAGG + Intergenic
1127361807 15:58251023-58251045 ACTTGGAGGAAGGTGGGGAGGGG + Intronic
1127601702 15:60544001-60544023 AAGTGGAGGAAGTGGGAGAGAGG + Intronic
1127800296 15:62471877-62471899 AGCAGGAGGATGGGGGGCAGAGG + Intronic
1128052853 15:64678686-64678708 AGCTGGAGCAAGGGAGAGAGAGG - Intronic
1128730580 15:70018228-70018250 ACCTGGAGGGCAGGGCAGAGGGG + Intergenic
1129242116 15:74257935-74257957 TTCTGGAGGATGGGGGAGGCAGG + Intronic
1129248084 15:74292184-74292206 ACCTGGAGGAAAGGAGAGCGAGG + Intronic
1129355836 15:74990908-74990930 ACCAGGAGCATGGGGGAGACTGG + Intronic
1129462513 15:75706660-75706682 CCTTGGAGGATGGGGGAAAAGGG + Intronic
1129701833 15:77772772-77772794 AGCTGGAGGTGGGGGGAAAGAGG - Intronic
1129722351 15:77884754-77884776 CCTTGGAGGATGGGGGAAAAGGG - Intergenic
1130114777 15:80997200-80997222 GACTGGAGGAAGGGGGAGTGGGG + Intergenic
1130553353 15:84905762-84905784 ACCTGGAGGGTGGGGTGGACTGG + Intronic
1130842254 15:87711769-87711791 AGCTGGAGGCAGGGGTAGAGGGG + Intergenic
1131182430 15:90249707-90249729 ACCTGGAGCCGGGGGAAGAGGGG + Exonic
1131511270 15:93050800-93050822 ACCTGCAGGATGGGACAGGGAGG + Intronic
1131665213 15:94564264-94564286 AGCAGGAGGAAGGGAGAGAGGGG + Intergenic
1132063895 15:98714733-98714755 ACCTGCTGGATGGGGGGAAGAGG + Intronic
1132143774 15:99414968-99414990 ACCTGGAGGAGGTGGGAATGAGG - Intergenic
1202956854 15_KI270727v1_random:84736-84758 GCCTGTAGGCAGGGGGAGAGAGG + Intergenic
1132669890 16:1098217-1098239 AGCTGAAGGCTGGGAGAGAGGGG - Intergenic
1132721781 16:1320153-1320175 ACCTGGAGGAAGAGGAAGAAAGG - Exonic
1133110206 16:3543500-3543522 ACCTGGAGACTGGGGCGGAGAGG + Exonic
1133272827 16:4619030-4619052 ACCTGGACGATGGTGGAAGGAGG - Intronic
1133474876 16:6111097-6111119 CCTTGAAGGATGGGCGAGAGAGG + Intronic
1134059809 16:11192330-11192352 CCCTGGAGGACTGGGGGGAGAGG + Intergenic
1134081531 16:11328168-11328190 ACCAGGAGGGGTGGGGAGAGGGG - Intronic
1134186309 16:12087818-12087840 ACCAGGAGGAAGAGGGAAAGAGG - Exonic
1134769944 16:16799562-16799584 GGCTGGAGGAAGGGGGAAAGAGG - Intergenic
1135048490 16:19173386-19173408 GGCGGGGGGATGGGGGAGAGGGG - Intronic
1135543641 16:23351475-23351497 AACAGGAGGATGGGGAAGGGTGG - Intronic
1135628991 16:24021366-24021388 AGATGGAGGAGGGGGGAGGGAGG - Intronic
1135735745 16:24930848-24930870 ACCAGGAGGTTGGGGGGGTGGGG + Exonic
1135867711 16:26119557-26119579 ACCTGGCTGCTGGGGGAGGGAGG + Intronic
1136043845 16:27600594-27600616 ACCAGGAGAATGGGGGAGGGCGG - Intronic
1136081437 16:27854808-27854830 ACCTGAAGGATGATGGAGAGAGG + Intronic
1136151976 16:28356826-28356848 ACCTGGAGGAGGTGGAGGAGGGG + Intronic
1136505064 16:30698111-30698133 AACTGGAGGGTGGGGGAACGGGG - Intergenic
1136616061 16:31399319-31399341 AGCTGGAAGATGGGTCAGAGGGG - Intronic
1137450867 16:48572413-48572435 TTCTGGATGATGGGGGAGGGGGG + Intronic
1137870710 16:51947588-51947610 GCCTGGAGGCTGGGGGAGTGTGG - Intergenic
1137951599 16:52789098-52789120 ACGTTGAGGATAGGTGAGAGTGG + Intergenic
1138378924 16:56586969-56586991 ACATGGAGGATGAGGGGTAGGGG + Intergenic
1138382020 16:56609108-56609130 CCCCTGAGGATGGTGGAGAGGGG - Intronic
1138416879 16:56876667-56876689 ACCAGGAGGAGGTGGGAGGGAGG - Intronic
1138435559 16:56997687-56997709 AACTGGGGGTTGGGGGACAGAGG - Intronic
1138442541 16:57043634-57043656 ACCTGTGGGATGGGGGACAGGGG - Intronic
1138505339 16:57475705-57475727 AGAAGGAGGAGGGGGGAGAGAGG - Intronic
1138540037 16:57682463-57682485 GCTTGGAGGGTGGGGGTGAGGGG - Intronic
1138548960 16:57736617-57736639 ACGTGTGGGATGTGGGAGAGCGG - Intronic
1138592988 16:58012724-58012746 CCCTGGATGAAGGAGGAGAGCGG + Intronic
1138615067 16:58158625-58158647 ACCCGAGGGATGGGGTAGAGTGG - Intronic
1139431396 16:66912782-66912804 AGCCTGAGGATGGGGTAGAGGGG - Exonic
1139480167 16:67226370-67226392 CCCTGGCAGATGGGGCAGAGTGG + Intronic
1139908450 16:70381901-70381923 ACCTGGAGGATGGCGCGGGGCGG + Intronic
1140327541 16:74019782-74019804 ACCTGGAGGGTGGTGGCTAGAGG - Intergenic
1140409489 16:74733435-74733457 AGCTGGGGGAAGGGGGAGGGAGG - Intronic
1140479938 16:75257008-75257030 GCCTGGGGGAGGGGGAAGAGAGG + Intronic
1141423572 16:83931899-83931921 TCCTGGTGGATGGGGGAGAGCGG + Intronic
1141660362 16:85438048-85438070 ATCTGGGGGAGGCGGGAGAGGGG + Intergenic
1141672896 16:85502134-85502156 AGCTGGAGGTTGGGTGAGATGGG + Intergenic
1141753428 16:85975211-85975233 ACCTTAAGGAGTGGGGAGAGGGG - Intergenic
1141887708 16:86904020-86904042 ACCCGGAGGAAGGGAGAGATAGG - Intergenic
1141945381 16:87305690-87305712 AGGTGGGGGATGGGGGACAGTGG - Intronic
1142021473 16:87785503-87785525 CCCTGGAGCCTGGGAGAGAGCGG - Intergenic
1142181732 16:88674510-88674532 CCCTGGAAGAGGGAGGAGAGTGG + Intergenic
1142449039 16:90163111-90163133 ACCTCGAGGATGGGAGGCAGGGG - Intergenic
1142887892 17:2924573-2924595 AGGTGGAAGATGGAGGAGAGAGG + Intronic
1143325044 17:6093146-6093168 ACCTGGGGAATGAGGGAGACTGG + Intronic
1144225464 17:13140677-13140699 AACTGGAGGGTAGGGGACAGTGG + Intergenic
1144465478 17:15493585-15493607 AGCAGGAGGATGGGAGAGAGAGG - Intronic
1144619633 17:16809224-16809246 ACCTGGGGTAAGGTGGAGAGAGG - Intergenic
1144893052 17:18506480-18506502 ACCTGGGGTAAGGTGGAGAGAGG + Intergenic
1145139165 17:20437812-20437834 ACCTGGGGTAAGGTGGAGAGAGG - Intergenic
1145950334 17:28812307-28812329 CCCGGGAGGATGGAAGAGAGGGG + Intronic
1146061073 17:29607721-29607743 ACCTGGAGGAGGAGGAGGAGTGG - Exonic
1146457370 17:33018168-33018190 AACTTTTGGATGGGGGAGAGAGG - Intronic
1146621384 17:34401252-34401274 ACAGGGAGGATGGGGCGGAGTGG - Intergenic
1146704707 17:34992574-34992596 ACCTGCAGGATGTGGTGGAGCGG + Exonic
1147186806 17:38717500-38717522 CCCAGGAGGCTGGAGGAGAGAGG - Exonic
1147377823 17:40033313-40033335 CCCTGGGGGATGGTGGAGAAGGG - Intronic
1147996274 17:44362087-44362109 ACCTTGCGGGTGGGGGAGAAGGG + Intronic
1148155908 17:45425220-45425242 ACCTGGGGGTTGGGGGTGGGGGG + Intronic
1148209551 17:45799989-45800011 AGCTGGAGGTCGGGGCAGAGTGG - Intronic
1149027000 17:52038223-52038245 ACAGAGAGGATGTGGGAGAGGGG + Intronic
1149535820 17:57432565-57432587 ACCTGGAGGAAGAGGGAGAGTGG - Intronic
1149698735 17:58637604-58637626 TCCTGGAGGATGGGCCAGGGAGG + Intronic
1150425609 17:65074772-65074794 TGCTGGGGGCTGGGGGAGAGGGG - Intergenic
1150605827 17:66690047-66690069 ATCTGGGGGGTGGGGAAGAGTGG + Intronic
1151321744 17:73356686-73356708 ACAGGGAGGAGGGAGGAGAGGGG - Intronic
1151775458 17:76198205-76198227 ACCTGGAGGATGTGTGGGAGGGG + Intronic
1151896709 17:76985684-76985706 AGCTGGAGGGAGGGGGAGTGGGG + Intergenic
1151989671 17:77566284-77566306 AGCAGGAGGAAGGGAGAGAGCGG + Intergenic
1152110951 17:78357623-78357645 AGCGGGAGGATGGAGGAGACGGG - Exonic
1152140426 17:78533298-78533320 ACCTGAAGCAAGGGGGAGGGTGG - Intronic
1152292731 17:79449396-79449418 ACCTGGAGGCAGGTTGAGAGGGG - Intronic
1152326968 17:79647317-79647339 AACTGGAGGCTATGGGAGAGAGG - Intergenic
1152334145 17:79690731-79690753 ACGAGGAGGATGGGGTGGAGGGG + Intergenic
1152538884 17:80964993-80965015 ACCTGGAGGTGCGGGGAGGGTGG - Exonic
1152632491 17:81416833-81416855 ACTTGGAGGATGGGAGAGGCTGG + Intronic
1152639529 17:81443842-81443864 ACCTGGAGGCTGAGGAGGAGAGG + Exonic
1152689406 17:81711250-81711272 CCCTGGAGGGTGGGGGAGGCCGG + Intergenic
1152694631 17:81737955-81737977 ACCTGGAGTGTGGGTGGGAGCGG + Intergenic
1152744728 17:82033467-82033489 ACCAGGAGGATGGGCGTGTGGGG - Exonic
1152818564 17:82423910-82423932 ACCTGGGGGAGGTGAGAGAGGGG - Intronic
1203165081 17_GL000205v2_random:86664-86686 ACCTGGAGGGAGGGACAGAGCGG - Intergenic
1153002940 18:472887-472909 ACCTGGAGCACCTGGGAGAGAGG + Intronic
1153262526 18:3238368-3238390 ACCTGGGGGAGGGGGGAGGCAGG + Intergenic
1153263410 18:3245936-3245958 ACCTTGGGGATGGGGGCGGGAGG - Intergenic
1153328324 18:3845384-3845406 ACTTGGGGGTGGGGGGAGAGTGG + Intronic
1153912008 18:9712645-9712667 AGCAGGAGGAAGGGAGAGAGTGG + Intronic
1153994276 18:10426220-10426242 ACGAGAAGGATGGGGCAGAGAGG - Intergenic
1155064680 18:22258114-22258136 TCCTTGAGGGTGGTGGAGAGCGG + Intergenic
1155071285 18:22318647-22318669 AGATGGAGGATGGGGGAAAAGGG + Intergenic
1155177112 18:23310519-23310541 ACCTGCAGGATGTGGAAGACTGG - Intronic
1155334379 18:24749620-24749642 ACCTGAAGGAGGAGGCAGAGGGG - Intergenic
1155550489 18:26959854-26959876 ACCTTGAGGATGGGGGATCCTGG + Intronic
1155576400 18:27252495-27252517 ACTGGGAGGAGGGGGGAAAGAGG + Intergenic
1156293920 18:35773282-35773304 ACCTGGAGGATGGAGGCCAAGGG - Intergenic
1156592667 18:38509234-38509256 AGCAGGAGGATGGGGGATGGGGG + Intergenic
1156675887 18:39526733-39526755 AACTGGAGGTGGGGGAAGAGGGG + Intergenic
1157426982 18:47592482-47592504 ACCAGGAGGATGAGGAGGAGTGG - Intergenic
1158119703 18:54035277-54035299 ACTTGGAGAAATGGGGAGAGAGG + Intergenic
1158717041 18:59889573-59889595 ACCTGGAGGATGAAGGAGGAAGG + Intergenic
1158782095 18:60663675-60663697 ACTTGCAGGATGGGATAGAGCGG + Intergenic
1159029711 18:63218649-63218671 GACTGGAGGATGGGGATGAGTGG - Intronic
1159051074 18:63422080-63422102 ACCTGCAGCAGGTGGGAGAGGGG - Intronic
1159166581 18:64710086-64710108 TCCTGGAGGATGGTGGGGATGGG + Intergenic
1159442115 18:68494812-68494834 AAATGGAGGGTGGGGGAGTGAGG - Intergenic
1160024974 18:75209381-75209403 GCCAGGAGGAAGGGGGAGGGCGG - Intergenic
1160315632 18:77843122-77843144 ATTTGAAGGATGTGGGAGAGAGG - Intergenic
1160437524 18:78862883-78862905 ACCTGGAGGGTGGGGGATGGTGG + Intergenic
1160648167 19:204689-204711 ACCTCGAGGATGGGAGGCAGGGG + Intergenic
1161046854 19:2139696-2139718 ACCTGTCGGATGATGGAGAGGGG - Intronic
1161220825 19:3117341-3117363 GCCTGGAAGATGGTGGAGAGGGG - Intronic
1161241587 19:3226130-3226152 TCCTGGAGGATGGGAGGGGGAGG - Intronic
1161400988 19:4066195-4066217 CCATGGGGGATGGGGGGGAGGGG - Intronic
1161532812 19:4800374-4800396 ACCTGGGAGATGGGGAAGTGGGG + Exonic
1161664217 19:5565151-5565173 GGCTGGAGCAAGGGGGAGAGAGG - Intergenic
1161670163 19:5602911-5602933 ACTTGGAGGAGGGGGGTGGGGGG - Intronic
1161992091 19:7689965-7689987 ACCTGGAGGAGGGGATATAGAGG - Intronic
1162115895 19:8429154-8429176 ACGTGAAGAATGGGGGAGATGGG - Intronic
1162145735 19:8611260-8611282 GCCTGGAGGAAGGGGCTGAGTGG + Intergenic
1162329897 19:10021372-10021394 TCCTGGAGGCTGGGAGATAGAGG - Exonic
1162558082 19:11400038-11400060 ACCTGGAGGTGGGGGATGAGGGG + Exonic
1162790027 19:13057977-13057999 TCCTGGAGGGCTGGGGAGAGAGG + Intronic
1163402621 19:17103378-17103400 ATCAGGAGGCTGAGGGAGAGAGG + Intronic
1163676134 19:18656184-18656206 ACCTGCAGGATGGGGGTGGACGG + Intronic
1163749211 19:19065241-19065263 TCCTGCAGGATGCCGGAGAGGGG + Intronic
1164202206 19:23028286-23028308 AGCTGGTGGAGGGGGCAGAGTGG + Intergenic
1164503617 19:28840111-28840133 ACCTAGAAGCTGGGGGACAGAGG - Intergenic
1165027268 19:32971082-32971104 ACCTAGGGGAAGGGCGAGAGTGG + Intronic
1165147309 19:33739255-33739277 TTGTGGAGGAGGGGGGAGAGAGG - Intronic
1165756479 19:38296163-38296185 CCCAGGAGGTGGGGGGAGAGGGG + Intronic
1165925998 19:39326693-39326715 ACGAGGAGGAGGGGGGGGAGGGG + Intergenic
1166045351 19:40226628-40226650 TCCTGGAGGATGCTGGTGAGAGG - Exonic
1166101893 19:40576237-40576259 AACTGGAGGGGGGAGGAGAGAGG - Exonic
1166184584 19:41131490-41131512 ACACAGAGGTTGGGGGAGAGAGG + Intergenic
1166309975 19:41957346-41957368 TCCTGGAGGATGTGGGGCAGAGG - Intronic
1166870705 19:45868738-45868760 AGGTGGAGAATGGGGCAGAGAGG + Intronic
1167169317 19:47820686-47820708 ACATGGAGGCTGAGGGAGAGGGG + Intronic
1167291109 19:48625716-48625738 ACCTTGAGGATGCGGGACAGAGG - Intronic
1167660148 19:50791635-50791657 ACCTGGAGCGGGGTGGAGAGAGG - Exonic
1168020624 19:53606434-53606456 ACCTGGAGGAAAGGGCACAGAGG + Intergenic
1168072080 19:53958985-53959007 ACTGAGAGGATGGGGGAGAGAGG - Intergenic
1168113855 19:54209812-54209834 CCCTGAAGGATGGGGCTGAGGGG + Intronic
1168152422 19:54456198-54456220 ACCTGGAGGAGGAGCGGGAGCGG - Exonic
1168290597 19:55355205-55355227 ACCTGGGGGCGGGGGGAGGGGGG - Intronic
1168520896 19:57049811-57049833 AGCTGGAGGATGGGGTGGGGTGG - Intergenic
924973303 2:151033-151055 ACCTGGAGCATGGGTGTGAGTGG + Intergenic
925191901 2:1891988-1892010 ACCTGGCGGGTGGGGGAGGCCGG - Intronic
925256181 2:2490642-2490664 ACCTGGAGGAGGGTGGACACAGG + Intergenic
925281780 2:2690183-2690205 GCATGGAGGGTGGGGGAGTGAGG - Intergenic
925637291 2:5952368-5952390 TCCTAGAGGATGTGGGAGAGAGG - Intergenic
926707027 2:15844206-15844228 ACCTGGAGGCGGGTGAAGAGGGG - Intergenic
927035427 2:19170274-19170296 ACCTGGCAGATGGGAGAGAAGGG + Intergenic
927103623 2:19806556-19806578 ACCCAGAGGCTGTGGGAGAGTGG - Intergenic
927289407 2:21390569-21390591 AACATGAGGATGGGGGAGTGGGG + Intergenic
927927955 2:27026259-27026281 TCCTGGAGGGTGGGAGAGAGAGG - Exonic
928116077 2:28545999-28546021 GCTTGGAGGATGAGGGAGGGAGG - Intronic
928415059 2:31085229-31085251 GCCTGGAAGATGAGGGAGTGGGG - Intronic
928466930 2:31531115-31531137 ACCCGGAAGGTGGGAGAGAGTGG - Intronic
929087410 2:38182037-38182059 GCCTGGAGGGCTGGGGAGAGTGG + Intergenic
930783086 2:55242643-55242665 ACCAGGAGGAGTAGGGAGAGGGG + Intronic
930887785 2:56347710-56347732 AACTGGAGGAGGGTGGATAGGGG + Intronic
931487369 2:62706226-62706248 TCCCTGAGGATGGGGGAGGGAGG + Intronic
931516880 2:63055300-63055322 AGCAGAAGGATGGGGGAGGGTGG + Intronic
931635033 2:64333155-64333177 ACCTGGGTGCTGGGGGACAGGGG - Intergenic
931839358 2:66132177-66132199 ACCTGGAGCATGGTGGGGAGGGG + Intergenic
932300722 2:70665209-70665231 ACATGGAGGATGGGACAGAGTGG + Intronic
932605700 2:73163967-73163989 CCCTGAAGGAATGGGGAGAGTGG - Intergenic
932980470 2:76659565-76659587 ACCTAAAGGTTGGTGGAGAGAGG - Intergenic
933587342 2:84193790-84193812 ATCTGGAGGATGCAGGTGAGGGG + Intergenic
935235880 2:101138067-101138089 AGCAGGAGGAAGAGGGAGAGGGG + Intronic
936600798 2:113892253-113892275 ACCAGTAGGATCGGGAAGAGGGG + Intronic
936659279 2:114524221-114524243 ATGTGGAGGATGGGTTAGAGAGG + Intronic
937236660 2:120435354-120435376 AGGTGGAGGCTGGGGGAGGGAGG + Intergenic
937239655 2:120451917-120451939 GCCTGGAAGATGGGGAAGAAGGG + Intergenic
937309273 2:120892131-120892153 CCCTGGCTGACGGGGGAGAGAGG - Intronic
937808101 2:126169393-126169415 AGCTGGAGGTTGGGGGCTAGGGG + Intergenic
937882304 2:126877706-126877728 ACAAAGAGGGTGGGGGAGAGAGG - Intergenic
937917326 2:127105657-127105679 TGCTGGGGGATGGGGGAGAGGGG - Intronic
938094951 2:128455597-128455619 GCCTGGAGGCTGGAGGAGAGTGG - Intergenic
938270422 2:129965366-129965388 TCCTGGATGATGGGGGAGGTGGG + Intergenic
938731284 2:134149972-134149994 AACTGGAGGAAGGAAGAGAGAGG - Intronic
941591133 2:167422068-167422090 AGGAGGAGGATGAGGGAGAGGGG + Intergenic
942125229 2:172818177-172818199 ACTTGGGGGAAAGGGGAGAGAGG + Intronic
943484611 2:188464384-188464406 ACCTGGAGCAGAGGGTAGAGTGG + Intronic
943844965 2:192634407-192634429 TGCTGGAGGATGGGGGGGATTGG - Intergenic
944097576 2:195986131-195986153 AGATGGAGTTTGGGGGAGAGGGG - Intronic
944856745 2:203775483-203775505 AGCTGGAGGATGGGGGTGAGTGG - Intergenic
945139443 2:206668258-206668280 ACCTGGTGGATAGGCCAGAGTGG - Intronic
946071170 2:217035519-217035541 CCCTGGAGGATGGATGAGGGTGG + Intergenic
946446760 2:219746604-219746626 ACCTGGAGGATGGGAGATGGTGG + Intergenic
946937147 2:224734085-224734107 ACCTGGAGGTTCTTGGAGAGTGG - Intergenic
947152334 2:227128615-227128637 ACATGGAGAATGAGGGAAAGAGG - Intronic
947905350 2:233757288-233757310 AGCTGGGGGTTGGGGGACAGGGG + Intronic
947948225 2:234124788-234124810 CCCTGGAGGCTGGTGGTGAGGGG - Intergenic
948145240 2:235703584-235703606 GCCTGGAGGATGGGCGGGGGAGG - Intronic
948932705 2:241142241-241142263 ACCTGGAAAATGGGGAAGTGGGG - Intronic
948934440 2:241153563-241153585 GCCTGAAGGATGGGGAGGAGCGG + Exonic
1168810822 20:703532-703554 ACGTGGAGGGTGGGTGAGAAGGG + Intergenic
1169081431 20:2799767-2799789 GCCGGGAGGATGGGGCAGAGCGG - Intronic
1169433072 20:5556867-5556889 CCCAGGAGGATGGAGGAAAGGGG + Intronic
1170838406 20:19904441-19904463 ACTTGAAGGATGGGGATGAGGGG + Intronic
1171783797 20:29445116-29445138 AACTGGAAGAAGGGGCAGAGTGG - Intergenic
1171851881 20:30314666-30314688 GGCTGGAGAATGAGGGAGAGAGG - Intergenic
1172012364 20:31852971-31852993 GCCTGGAGGATTGGGGATGGGGG + Intronic
1172270077 20:33650111-33650133 TCCTTGAGGAAGAGGGAGAGAGG + Intergenic
1172271463 20:33657849-33657871 ACCAGGAGGCTGGGGGTCAGAGG + Exonic
1173035705 20:39407532-39407554 ACCTGGAGGGAGGGGGAAATCGG + Intergenic
1173204291 20:40980399-40980421 ACCTGGAGTTGGGGGGAGGGTGG + Intergenic
1173289066 20:41698571-41698593 AGGTGGAGTTTGGGGGAGAGGGG + Intergenic
1173550824 20:43932072-43932094 ATCTGGGGTATGGTGGAGAGTGG + Intronic
1173794161 20:45847331-45847353 ACCAGGGGCCTGGGGGAGAGAGG + Intronic
1174041565 20:47703997-47704019 TCCTGGAGACTGGGGGAGGGTGG + Intronic
1175127702 20:56764750-56764772 GCCTGGTGGGTGGGGGAGAGTGG + Intergenic
1175560874 20:59929205-59929227 ATATGGTGGATGGTGGAGAGGGG - Intronic
1175820608 20:61907013-61907035 ACCTGGAGCAGGGAGGAGGGTGG - Intronic
1175934381 20:62508295-62508317 ACCTGCAGGAGGGGGAAGAACGG + Intergenic
1176218255 20:63958204-63958226 CCCTGGGGAATGGGGGAGGGTGG + Exonic
1176336567 21:5604450-5604472 CCCTGGAGGGAGGGGCAGAGCGG + Intergenic
1176379718 21:6106154-6106176 GCCCGGACCATGGGGGAGAGAGG - Intergenic
1176391190 21:6216498-6216520 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
1176406669 21:6372427-6372449 ACCTGGAGGGAGGGACAGAGCGG + Intergenic
1176470229 21:7099676-7099698 CCCTGGAGGGAGGGGCAGAGCGG + Intergenic
1176493790 21:7481454-7481476 CCCTGGAGGGAGGGGCAGAGCGG + Intergenic
1176506852 21:7656929-7656951 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
1176904614 21:14484385-14484407 ACCTTTAGGATGGAGGAAAGAGG + Intergenic
1177149347 21:17438952-17438974 AGCTGGAGGATGGAGCAGATTGG - Exonic
1177175484 21:17697224-17697246 GCCTGGAGGGTGAGGGAGGGAGG + Intergenic
1178403443 21:32306291-32306313 TCCTGAAGGATGGGAGGGAGAGG - Intronic
1178513399 21:33226436-33226458 TCCTGGAGGTTGGGGTGGAGGGG + Intergenic
1178610281 21:34073678-34073700 GCCTGGAGGATCGGCGAGTGCGG - Exonic
1179359258 21:40690023-40690045 GCCTGGGTGATGGGGGAGGGAGG + Intronic
1179403221 21:41103271-41103293 GCCTGGGGGAGGGGGAAGAGGGG - Intergenic
1179487516 21:41719940-41719962 TTCTGCAGGATGGGGGTGAGGGG + Intergenic
1179558531 21:42196061-42196083 TCCTGGAGAAAGGGGGAGAGTGG + Intergenic
1179743756 21:43432083-43432105 GCCCGGACCATGGGGGAGAGAGG + Intergenic
1179918613 21:44494670-44494692 ACCGCAGGGATGGGGGAGAGGGG + Intergenic
1179982611 21:44904177-44904199 GGCTGGAGGGTGGGGCAGAGGGG - Intronic
1180082039 21:45491392-45491414 ACCTGGGGGATGTGGGGGTGTGG - Intronic
1180186864 21:46144550-46144572 AGAGGGAGGAGGGGGGAGAGAGG - Intronic
1180980819 22:19877239-19877261 ACATGGGGGATGGGGGAGGCAGG + Intronic
1181112729 22:20611463-20611485 ACCTCCAGGCTGGGGGAGTGCGG - Intergenic
1181463176 22:23097166-23097188 ACCCTGGGGATGGGGGAGTGGGG + Intronic
1181495191 22:23283690-23283712 GGTGGGAGGATGGGGGAGAGGGG - Intronic
1181672320 22:24431461-24431483 ACATGGACAATGGGGTAGAGGGG + Intronic
1181963485 22:26640046-26640068 AGCTGGAGGAGGGGGTGGAGGGG - Intergenic
1182048974 22:27298882-27298904 AAATGGAGAATGGGAGAGAGAGG + Intergenic
1182106184 22:27691446-27691468 GCCTGGAGGATGGGTTAGTGGGG - Intergenic
1182144980 22:27992025-27992047 ACCTGGTGGCTTGGGGAGGGTGG + Intronic
1182266440 22:29119429-29119451 CCCTGGAGGATGTGGGGGTGTGG + Intronic
1182319959 22:29472159-29472181 ACATGGAGGATGAGGGAGAAAGG + Intergenic
1182759221 22:32708602-32708624 ACCCGGTGGTTTGGGGAGAGAGG + Intronic
1183215148 22:36474534-36474556 ACCTGGAGGAGGAAGGAGGGAGG + Intronic
1183313685 22:37125488-37125510 ATCTGGAGGGAGGGGGATAGAGG + Intergenic
1183688892 22:39377161-39377183 ACCAGAAGGATGGGGGAAACAGG - Intronic
1183715047 22:39528599-39528621 AGCTGAAGGATGGAGGCGAGGGG - Intergenic
1183864635 22:40694491-40694513 ACAATGAGGATGGGGGAGAGCGG - Intergenic
1184151817 22:42643836-42643858 ACCTGGAGGATGGGGAGGGTGGG + Intronic
1184242190 22:43217107-43217129 ACCTGGCGGATGGGGGGTGGGGG - Intronic
1184539079 22:45107806-45107828 ACCTGGTGAGTGAGGGAGAGAGG - Intergenic
1184802108 22:46767748-46767770 ACCAGGAGGCTGGGGAAGAGCGG + Intronic
1185140748 22:49099848-49099870 TCCTGGAGGCTGTGGGAGTGTGG + Intergenic
1185172716 22:49303163-49303185 TCCTGGAGGATGGTGGAAATGGG + Intergenic
1185289378 22:50015988-50016010 ACCTGGAGGAGGGCTGAGAGAGG - Intronic
1185296873 22:50058766-50058788 TCCTGGCGGATGGGGGCGACGGG + Intergenic
949160018 3:870378-870400 AACTGGGGGATGGGGGAGAACGG - Intergenic
949397725 3:3633024-3633046 GGTTGGAGGATGGGGGAGACAGG + Intergenic
950105257 3:10384599-10384621 GGGTGGAGGGTGGGGGAGAGGGG - Intronic
950215557 3:11155746-11155768 CCCTGGAGCATGAAGGAGAGGGG + Intronic
950475361 3:13211426-13211448 ACCTGGGGCAGGGGGCAGAGGGG - Intergenic
950881084 3:16323134-16323156 GCCAGAAGGATGGAGGAGAGAGG - Intronic
952207171 3:31191701-31191723 AGCCAGAGGATGGGGGAAAGAGG - Intergenic
952341635 3:32452184-32452206 ACCTGGAGGACTGGGGCCAGTGG + Intronic
952573007 3:34740448-34740470 GCCTGGAGGATAAGGAAGAGAGG + Intergenic
953208271 3:40851391-40851413 ATATGGGGGATGGGGAAGAGAGG - Intergenic
953345586 3:42172644-42172666 GCCTGGAGGATGGGGCTCAGGGG - Intronic
953410608 3:42688589-42688611 ACCTGGAGGAGACGGGAGTGGGG - Exonic
953561460 3:43996225-43996247 CCCTGGAGGTTGTGGGAGCGGGG - Intergenic
953815544 3:46153460-46153482 ACCTGGAGGGAGGGGCAGAGAGG - Intergenic
954111412 3:48435422-48435444 ACCTGGAGGATGTAGGGAAGTGG - Intronic
954288178 3:49634224-49634246 AGCTGGAGGAAGGGGGAATGGGG + Intronic
954334027 3:49905748-49905770 ATAAGGAGGCTGGGGGAGAGAGG + Intronic
954391534 3:50270408-50270430 ATCGGGAGGTTGGGGGAGAGGGG - Intronic
956796547 3:72723304-72723326 ACCTACAGGACTGGGGAGAGGGG - Intergenic
956833137 3:73073161-73073183 GCCTGGGGCATGGGGGAGAGGGG - Intergenic
957061275 3:75483098-75483120 GCATGGAGGATGGGGGAGATGGG + Intergenic
957081661 3:75641417-75641439 CCCTGGAAGAAGGGGCAGAGTGG + Intergenic
957081690 3:75641553-75641575 CCCTGGAGGGAGGGGCAGAGCGG + Intergenic
957630237 3:82708575-82708597 ATCTGGAGAATTGGAGAGAGAGG - Intergenic
958528957 3:95299630-95299652 AGCTGGAGGAAGAGGGAGAGGGG - Intergenic
958884594 3:99711595-99711617 ACCTGGGGGATGTGGGAGTGGGG + Intronic
959913844 3:111794313-111794335 ATCTGCATGTTGGGGGAGAGAGG - Intronic
960429922 3:117556778-117556800 ACCAGGAGGAAGGGAGAGAAGGG - Intergenic
960684462 3:120283382-120283404 AATTGGGGGAAGGGGGAGAGAGG - Intronic
960691242 3:120348873-120348895 ACCTGGAGGCTGCGGCAGAGCGG + Exonic
960976547 3:123180932-123180954 ACCTGGAAGGTGGAGGAGATTGG + Intronic
961346854 3:126268614-126268636 AGCTGGAGGTTGGGGGCGGGGGG + Intergenic
961415449 3:126753368-126753390 ACCTGGAGGCTGAGGAGGAGGGG + Intronic
961567194 3:127772268-127772290 ACTTAGAGGTTGGGGGAGCGGGG - Intronic
961788098 3:129359432-129359454 ACCTGGGGCAGGGGGCAGAGGGG + Intergenic
961858022 3:129892865-129892887 CCCTGTAGGATAGGGGAAAGAGG - Intronic
962418883 3:135209816-135209838 GCATGGAGGATGGGTGGGAGAGG + Intronic
962607387 3:137044230-137044252 ACCTGGAGGCTGGGAGTGGGAGG + Intergenic
962752760 3:138445931-138445953 AGGTGGAGGATGGGGAGGAGAGG + Intronic
963430549 3:145196885-145196907 AGTTGGGGGATGGGGGACAGAGG - Intergenic
963774487 3:149424056-149424078 AACTGGAGCCTGGGAGAGAGAGG + Intergenic
964362384 3:155912264-155912286 ACCTTAAGGATGTGGGATAGAGG + Intronic
964876555 3:161373580-161373602 AACTGGAGGTTGGGGGAAACTGG + Intergenic
965333294 3:167404536-167404558 GCGTGGAGAAAGGGGGAGAGTGG - Intergenic
965799438 3:172476390-172476412 TCCTGGAGCTTGGGGGAAAGAGG + Intergenic
966305742 3:178532696-178532718 AACTGGAGACTGGGGGAGAGTGG - Intronic
967762652 3:193242384-193242406 ACCTGGGGAGTGGAGGAGAGAGG + Intronic
968369680 3:198215426-198215448 ACCTCGAGGATGGGAGGCAGGGG - Intergenic
968558163 4:1261021-1261043 ACCCAGAGGATGGGGCAAAGTGG - Intergenic
968609252 4:1549663-1549685 ATCTGGAGGATGGGGCAGAGAGG - Intergenic
968756276 4:2417966-2417988 ACCGGGATGAGGAGGGAGAGGGG + Intronic
968842931 4:3021357-3021379 AGTTGGAGGATGTGGGGGAGGGG - Intronic
968956279 4:3721404-3721426 ACCTGGGGGCTGGGGGTGGGAGG + Intergenic
969248930 4:5954517-5954539 ACTGGGAGGATGGGGGAGGGGGG + Intronic
969301624 4:6300491-6300513 ACCTGGAGAAGGGGGGAGGGAGG + Intronic
971265667 4:25094353-25094375 CCCTGGGGGGTGGGGGACAGTGG - Intergenic
971480429 4:27109731-27109753 CGTTGGAGGTTGGGGGAGAGGGG - Intergenic
971725730 4:30309034-30309056 AACTTGAGGATGTGTGAGAGAGG - Intergenic
972328273 4:38039007-38039029 ACCTGGGGGAAGGGGTAGTGAGG - Intronic
972982803 4:44726318-44726340 ACCTCGAGGCTGGGGGCGCGTGG - Intronic
975552903 4:75631085-75631107 AGATGGAGGAAGGGGAAGAGAGG + Intergenic
976043433 4:80915609-80915631 AACAGGAGGATCTGGGAGAGTGG - Intronic
976125515 4:81829879-81829901 ACCCAGAGGAAGGGGGAGGGAGG + Intronic
977938016 4:102827762-102827784 ACCAGGAGGGCGGGGGAGGGAGG + Intronic
978469999 4:109054982-109055004 AGCTGGAGGATGGGGGAGGTTGG - Intronic
978527835 4:109683385-109683407 ATTTGGAGGATGGCAGAGAGAGG + Intronic
978654237 4:111048157-111048179 ACTTGGAGGTTGGGGGGGAGGGG - Intergenic
979831757 4:125314250-125314272 ACCTGGAAGGTGGGGGAGAGGGG + Intergenic
980877669 4:138678242-138678264 GGCTGGAGGATGAGGGAGATTGG + Intergenic
981316316 4:143343141-143343163 ACCTGTAAAATGGGGGAGGGAGG + Intronic
981767307 4:148266021-148266043 ACGGGGAGGGTGGGGGAGACAGG + Intronic
982016639 4:151161185-151161207 ACCTGAAGGATTGGTGAGGGAGG + Intronic
982072602 4:151708638-151708660 ACCTGGAGGAAGGAGGAGGGGGG - Intronic
984744472 4:183201149-183201171 ATCTGGAGAATGTGGGAGATGGG - Intronic
984814454 4:183823549-183823571 ACCTGGAAGATGAGGGAATGTGG + Intergenic
985235181 4:187865111-187865133 TGCTGGAGGGTGGGGGTGAGGGG - Intergenic
985449180 4:190049427-190049449 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
985449211 4:190049563-190049585 CCCTGGAAGAAGGGGCAGAGTGG - Intergenic
985451958 4:190067578-190067600 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985452945 4:190070869-190070891 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985453934 4:190074162-190074184 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985454922 4:190077455-190077477 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985455908 4:190080752-190080774 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985456893 4:190084046-190084068 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985457881 4:190087342-190087364 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985458869 4:190090639-190090661 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985463121 4:190173402-190173424 ACGAAGAGGAAGGGGGAGAGGGG - Intergenic
985546611 5:513093-513115 ACCAGGAGGGTGAGGGAGGGGGG + Intronic
985550668 5:531954-531976 AGCTGCAGGATGGGGCAGAGTGG - Intergenic
985716790 5:1467467-1467489 ACCTGGAGCAGGAGGAAGAGAGG - Intronic
985760111 5:1744580-1744602 ACATGGAGCATGGAGGACAGCGG - Intergenic
986134114 5:4958489-4958511 ACTTGGAGAATGAGGCAGAGAGG - Intergenic
986392956 5:7302205-7302227 ACATGTAGGATGGGGGAGCGGGG - Intergenic
986709821 5:10480575-10480597 GCCTGGAGGATGGGGAGGGGAGG - Intergenic
987148133 5:15012452-15012474 AAGTGGAGGATGGAGGGGAGAGG + Intergenic
988047137 5:25971057-25971079 ACCAGGAGCATGAGAGAGAGGGG - Intergenic
988791300 5:34610301-34610323 AGCAAGAGGATGAGGGAGAGAGG - Intergenic
988918782 5:35921825-35921847 ACCAGGCAGATGGGGGTGAGGGG - Intronic
989243238 5:39223916-39223938 ACCTGGAGAAGAGGGGAGTGTGG - Intronic
990003624 5:50922169-50922191 ATCTGGAGGATGGGGCAGAGAGG + Intergenic
990547310 5:56835626-56835648 ACCTGGAGAAGGAGGGAGATGGG + Intronic
991506510 5:67329518-67329540 AGCTGGGGGATAGGGGATAGAGG - Intergenic
992140962 5:73796484-73796506 CCCTGGAGGCTGAGGGAGTGTGG + Intronic
992480745 5:77150290-77150312 TCCTGCAGGATGGGGGAGCTGGG - Intergenic
992863869 5:80938803-80938825 AAATGGGGGATGGGGGAGTGGGG + Intergenic
993564675 5:89458374-89458396 ACCTTGAGGATCTGGGAGAAAGG + Intergenic
996835271 5:127784719-127784741 ACCTGGAGGATAGCTGAGTGAGG + Intergenic
997315498 5:132931182-132931204 GGCAGGAGGATGGGGGAGTGGGG + Intronic
997351010 5:133231334-133231356 ACCAGGAGGATGGAGCAGTGTGG + Intronic
997520417 5:134520048-134520070 AGCTGGAGAATGGTGGAGACAGG + Intergenic
997777483 5:136624156-136624178 ACCTGAAGGATGGCTGAAAGAGG - Intergenic
997981422 5:138469943-138469965 ACCTGGGGAATGGGAGGGAGAGG - Intergenic
998042731 5:138963136-138963158 GTCTGGTGGCTGGGGGAGAGCGG + Intronic
998092556 5:139379833-139379855 ATCTGAAGGAGGGGGGTGAGGGG + Exonic
998515510 5:142750156-142750178 ACCTGGAGGATGGAGAAGATGGG + Intergenic
999011824 5:148050462-148050484 AGCTGGTAGATGGGTGAGAGAGG - Intronic
999173631 5:149616429-149616451 AACTGGAGGATCGCAGAGAGGGG + Intronic
999317718 5:150594954-150594976 ATGTGGAGGATGAGGGAGATGGG + Intergenic
999425163 5:151481675-151481697 CTTTGGAGGATGGGGGAGAGTGG - Intronic
1000220375 5:159209016-159209038 AGCTAGAGGATGGGAGGGAGGGG + Intronic
1000351814 5:160358248-160358270 ACCTAGAGGAAGGGAGGGAGAGG + Intronic
1000585189 5:163088552-163088574 ACCTGAAGAATGTGAGAGAGTGG - Intergenic
1001036481 5:168300349-168300371 AGATGCAGGATGGGGAAGAGGGG + Intronic
1001659913 5:173383650-173383672 ACCTGGAGGAAAGAGGGGAGAGG + Intergenic
1001787451 5:174425944-174425966 AGCTGGAGGCTGAGGGAGAGAGG - Intergenic
1001803584 5:174564468-174564490 AGATGGAGGAGCGGGGAGAGGGG + Intergenic
1002523941 5:179805735-179805757 GCCTGGAGGTTCCGGGAGAGTGG - Intronic
1003255702 6:4472988-4473010 AGTTGGAGGATGGGGGAAAGAGG - Intergenic
1004189513 6:13451595-13451617 ACCAGTAGCTTGGGGGAGAGGGG + Intronic
1005372756 6:25152863-25152885 ACCTGGCGGAAAGTGGAGAGGGG + Intergenic
1005839799 6:29736107-29736129 AACTGGGGGATGGAAGAGAGAGG - Intronic
1006361615 6:33590228-33590250 CCCTGCAGGCTGGGGGACAGAGG - Intergenic
1006447985 6:34090644-34090666 ACCTGGTGGAGGGGGCAGCGGGG - Intronic
1006630347 6:35426243-35426265 GGCTGGAGGAAGCGGGAGAGAGG - Exonic
1006912201 6:37570724-37570746 ACCAGGAAGATGGAGGAGATGGG + Intergenic
1007705945 6:43791498-43791520 ACCTACAGCATGGGGGATAGAGG + Intergenic
1008523210 6:52382182-52382204 AACTGGAGGATGCAGGAGAATGG + Intronic
1008634148 6:53392691-53392713 ACGTGGAGGTTTGTGGAGAGTGG - Intergenic
1009520101 6:64670892-64670914 AATTGGAGGGTGGGGGAGGGAGG - Intronic
1010677958 6:78766747-78766769 AACAGGAGGAAGTGGGAGAGTGG - Intergenic
1011594013 6:88998563-88998585 ACCTGGAGGCTGAGGCAGACGGG + Intergenic
1011715910 6:90104803-90104825 CCCTGTAGGATGGGGGACTGGGG + Intronic
1013022983 6:106238463-106238485 ATTTGGAGGAAAGGGGAGAGAGG - Intronic
1013293725 6:108740374-108740396 ACCTAGAGGACAGGTGAGAGAGG + Intergenic
1013363896 6:109420635-109420657 ATGGGGAGGATGGGGGAGAGAGG - Intronic
1013414433 6:109912362-109912384 GCCTGGGGGAAGGGGGAGAAAGG + Intergenic
1014744787 6:125187966-125187988 AGCTGGGGTATGGTGGAGAGTGG + Intronic
1015392770 6:132701786-132701808 ACCTGGAGGATGGGGGAGAGTGG - Intronic
1015749851 6:136549564-136549586 CCCTGGAGGTTGTGGGGGAGGGG + Intronic
1015920598 6:138262862-138262884 AGCTGAAGGATGGGGCTGAGTGG + Exonic
1016080574 6:139850053-139850075 TCCTGGGGGATGGGGGAGTGGGG - Intergenic
1016700368 6:147047688-147047710 AGCTGGAGCAAGGGGGAGGGAGG - Intergenic
1016741494 6:147533650-147533672 AGGAGGAGGAAGGGGGAGAGGGG - Intronic
1016772793 6:147870729-147870751 ATCTGGAGGCGAGGGGAGAGGGG + Intergenic
1018626105 6:165780574-165780596 CACTGGGGGATGGAGGAGAGAGG - Intronic
1018844521 6:167546639-167546661 ACATGGAGCATGGGTGAGAAAGG + Intergenic
1019168564 6:170115616-170115638 ACCTGGAGGATGTGGATGGGCGG - Intergenic
1019368373 7:647108-647130 CCCTGTAGGACGTGGGAGAGAGG - Intronic
1019556380 7:1633532-1633554 GGCAGGCGGATGGGGGAGAGGGG + Intergenic
1019631655 7:2052841-2052863 GCCTGGAGCATGGGGGAGGGAGG + Intronic
1019838576 7:3415909-3415931 ATGAGCAGGATGGGGGAGAGTGG - Intronic
1020080014 7:5282170-5282192 AGGGGGAAGATGGGGGAGAGGGG + Intronic
1020114050 7:5465662-5465684 ATCTGGAAAAAGGGGGAGAGAGG + Intronic
1020488194 7:8745432-8745454 ACCTGGGGGGTGGGGGTGGGTGG + Intronic
1020508669 7:9024521-9024543 ACATGGAGGATGAAGGAGAATGG + Intergenic
1022132141 7:27414516-27414538 ACCTGGGGTGTAGGGGAGAGGGG + Intergenic
1022193799 7:28043966-28043988 ACCAGGAGCAAGGGGGAGGGTGG + Intronic
1022322775 7:29303012-29303034 ACCTGGAAGATGGGCGGGACCGG - Intronic
1022473390 7:30695047-30695069 ACGGGGAGGAGGGGGAAGAGGGG + Intronic
1022552222 7:31251654-31251676 ACCTGGAGGAGGATTGAGAGAGG + Intergenic
1022639737 7:32170761-32170783 AGTTGGGGGTTGGGGGAGAGTGG - Intronic
1022837451 7:34131427-34131449 CCCTGGAGGATGCGGTACAGTGG - Intronic
1023221911 7:37928230-37928252 ACCTTGAGGATGGTGGTCAGGGG + Intronic
1023350455 7:39315542-39315564 TGCCGGAGGATGGAGGAGAGTGG - Intronic
1023490374 7:40733204-40733226 AGCTGGAGTGTGGGGCAGAGGGG - Intronic
1023984899 7:45088725-45088747 GCCAGGGGGATGGGGGAGAGGGG + Intronic
1024303333 7:47904616-47904638 ACCTGCAGGATGGGGAAAGGAGG + Exonic
1024681413 7:51693430-51693452 ACCAGGAGGAAGTGGGTGAGCGG + Intergenic
1025150091 7:56540928-56540950 ACCTGGAGGCTGAGGGTTAGGGG - Intergenic
1026598595 7:71754469-71754491 ACCGGGAGGAGGGGGAGGAGGGG - Intergenic
1026631797 7:72044187-72044209 ATTTGGAGGAGAGGGGAGAGAGG - Intronic
1026900286 7:74033318-74033340 ACGTGAAGAATGAGGGAGAGGGG + Intronic
1026929206 7:74213824-74213846 ACACGGCGGGTGGGGGAGAGTGG + Intronic
1026947431 7:74325397-74325419 ACCTGGAGGCTGGTGCAGACAGG + Intronic
1028621389 7:92833139-92833161 ACCTCGCGGATGGTGGAGAGCGG + Exonic
1029198014 7:98819915-98819937 ACCTGGAGGATTTGGGGCAGGGG + Intergenic
1029569490 7:101360305-101360327 ACCGAGAGGAGAGGGGAGAGGGG + Intergenic
1029684339 7:102135448-102135470 ACGTGGAGGAGGTGGGAGGGGGG + Intronic
1030055366 7:105579612-105579634 ATCTGGAAGATGGGTGTGAGTGG + Intronic
1031986675 7:128168149-128168171 ACCAGGAAGGTGCGGGAGAGGGG - Intergenic
1032054621 7:128674498-128674520 ATGTGCAGGAAGGGGGAGAGAGG - Intronic
1032056928 7:128691160-128691182 ATTTGGGGGATGGGGGAAAGGGG + Intergenic
1032155809 7:129466796-129466818 GCTTGGAGTATGGGGGAAAGGGG - Intronic
1032869176 7:135963303-135963325 ACCTGGGGGATTGGGTAGGGAGG - Intronic
1033130120 7:138738727-138738749 ACCTGTAAGATGGGAGAGACTGG + Intronic
1033936681 7:146593975-146593997 ACCTGGAGGATAGTGGAGGGTGG - Intronic
1034273775 7:149815386-149815408 TGCTGGGGGCTGGGGGAGAGGGG - Intergenic
1034497721 7:151432284-151432306 ACCTGGAGGCCAGGGGAGTGGGG + Intronic
1034686806 7:152979088-152979110 ACCTGGAGGAAGGGCCAGAGAGG + Intergenic
1035438358 7:158876192-158876214 AGCAGGAGGAAGGGAGAGAGTGG + Intronic
1035919525 8:3661966-3661988 ACCCAGAGGCTGCGGGAGAGAGG + Intronic
1035962098 8:4148641-4148663 ACCTTGTGGATGGCAGAGAGAGG + Intronic
1036223353 8:6939238-6939260 AGGAGGAGGATGGTGGAGAGTGG - Intergenic
1036648438 8:10626235-10626257 AGCGGGAGGATGGGGGAGGCTGG + Intronic
1037021491 8:13977042-13977064 ACCTTGGGGATAGGGGTGAGGGG - Intergenic
1037751687 8:21686486-21686508 TCCTGGAGGCTGGGGCAGGGTGG + Intergenic
1037941709 8:22956461-22956483 ACCAGGAGGAGGAGGGGGAGGGG - Intronic
1038359658 8:26864707-26864729 ACCTCGAAGATGGCGGAGAAGGG + Exonic
1038938173 8:32275522-32275544 AGCTGAAGGAAGGGAGAGAGTGG + Intronic
1039008558 8:33068309-33068331 ACCTGTAAGATGGGTGGGAGGGG + Intergenic
1042269694 8:66942480-66942502 AACTTGAGGAAGGGGGAAAGGGG - Intergenic
1042956630 8:74257967-74257989 ACCTGGAGAATGGGGGCAGGAGG - Intronic
1043498493 8:80829294-80829316 GCCTGGAGGTGGGGGGAGAGGGG + Intronic
1044610615 8:94088456-94088478 ACCTGGGGGAAGGGGTAGTGTGG - Intergenic
1044927526 8:97222237-97222259 AACTGGATGATCAGGGAGAGAGG - Intergenic
1045234994 8:100343874-100343896 CCATGGAGAATGGGGAAGAGAGG - Intronic
1045340901 8:101253600-101253622 ATATGGAGGGTGGGGGAGAGAGG - Intergenic
1045494332 8:102695673-102695695 ACCTGGAGGTTGGGGGACAGTGG + Intergenic
1046097732 8:109580438-109580460 ATTTGGAGGATGGGGGAAGGTGG + Intronic
1046102775 8:109633647-109633669 ACCTGGAGGGTGGGGTAGGGTGG + Intronic
1047285062 8:123480611-123480633 ATGTGCAGGATGAGGGAGAGGGG + Intergenic
1047404398 8:124573211-124573233 CCCTGGAGGATGAGAGGGAGAGG - Intronic
1047712213 8:127563902-127563924 ACCTGGAAACTGAGGGAGAGAGG + Intergenic
1047855108 8:128901001-128901023 ACCTGGAGCCTGGGGAAGAAGGG + Intergenic
1048121144 8:131583066-131583088 TGCTAGAGCATGGGGGAGAGTGG - Intergenic
1048196571 8:132336438-132336460 ACCTGCATGATGGGGGAGGCAGG + Intronic
1048895307 8:138987183-138987205 ACCTGGAGGATTGGGAGCAGAGG + Intergenic
1048981257 8:139704227-139704249 CCCTGGAGGCTGCGGGAGGGAGG - Intergenic
1049102223 8:140588018-140588040 CCTTGGAGGATGGAGGAGATGGG - Intronic
1049193398 8:141301624-141301646 ACCTGGAGGGTGGAGGTGGGAGG + Intronic
1049641638 8:143718703-143718725 ACCTGGGGGGAGTGGGAGAGGGG - Intronic
1049740610 8:144239237-144239259 AACTGGAGGATGGGGAAGTGGGG - Intronic
1050687252 9:8185754-8185776 AACTGGAGGATGGGGGAGGAGGG - Intergenic
1051505659 9:17824892-17824914 AGATGAAGGGTGGGGGAGAGAGG + Intergenic
1051875981 9:21793888-21793910 ACCTGGATGATGGGGGAAGGTGG - Intergenic
1052271231 9:26630298-26630320 ACCTGAGGGAAGGTGGAGAGAGG + Intergenic
1052353145 9:27477401-27477423 AGCAGGAGAATGGGAGAGAGAGG - Intronic
1052381103 9:27772005-27772027 AGCTGGAGGATGGGGGGAAGGGG - Intergenic
1052699599 9:31921837-31921859 ACCTGGAAGATGGAGTAGAGGGG + Intergenic
1052709962 9:32042144-32042166 AGCTGGAGGATGGGGGAGAATGG - Intergenic
1053131742 9:35619245-35619267 GCCTGGCTGATGGAGGAGAGAGG + Intronic
1053333978 9:37247083-37247105 ACCAGGAGTTTGGTGGAGAGGGG - Intronic
1053350511 9:37410715-37410737 ACCAGGAGGCTGGGGCAGAGGGG + Intergenic
1054907052 9:70420808-70420830 ACTGGGAGGAGGAGGGAGAGAGG - Intergenic
1055066560 9:72125036-72125058 TCCTGGATGATTTGGGAGAGAGG + Intronic
1055520012 9:77071219-77071241 ACCTGGTGGATAGGCAAGAGTGG + Intergenic
1056320336 9:85429506-85429528 GACTGGAGAATGGTGGAGAGTGG - Intergenic
1056516649 9:87358737-87358759 TGCTGGAGGATGGGGGAGGGGGG - Intergenic
1056951689 9:91045190-91045212 ACCTAGAGGGAGGGAGAGAGGGG - Intergenic
1057117729 9:92541435-92541457 ACCAGGAGGGTGGGGGTGTGGGG - Intronic
1057297755 9:93859466-93859488 ACCTGGAGGATGGGGTGCAGGGG - Intergenic
1057338227 9:94174443-94174465 ACCTGGAGGTTGAGGGGGTGAGG + Intergenic
1057736335 9:97664894-97664916 ACCTGAGGGATGGGGGAAAGGGG + Intronic
1058730161 9:107842237-107842259 GATTGGAGGATGGGGGAGATGGG - Intergenic
1059805241 9:117792357-117792379 CCCTGGGGGATTGGGGAGGGGGG + Intergenic
1060103087 9:120857136-120857158 ACCTGGGGGACGGGGGTGGGGGG - Exonic
1060156301 9:121322140-121322162 GTCTGGAGAATGGGGTAGAGAGG - Intronic
1060202408 9:121659125-121659147 CCCTGGCTGATGAGGGAGAGAGG + Intronic
1060258489 9:122053397-122053419 GCCTGGAGCCTGGGGGAAAGGGG + Intronic
1060298057 9:122356368-122356390 GTCTGGAGGATGGGGAGGAGGGG - Intergenic
1060432073 9:123559064-123559086 ATCTGAAGGATGGGTGAGGGTGG + Intronic
1060436616 9:123598401-123598423 ACTTTGAGGTTGGGGGAGGGGGG + Intronic
1060729326 9:126027329-126027351 ACCTGGAGGAAAGAGGAGAGGGG - Intergenic
1061079961 9:128364014-128364036 AGCTGCAGGGTTGGGGAGAGGGG + Intergenic
1061293820 9:129666569-129666591 AACTGGAGGGTGGGGGGGGGTGG - Intronic
1061406293 9:130394602-130394624 GGCTGGGGGTTGGGGGAGAGGGG + Intronic
1061433607 9:130546804-130546826 ACCTGCAGGGCGGTGGAGAGTGG + Intergenic
1061638935 9:131936257-131936279 TCCTGGAGGCTTGGGGAGATAGG + Intronic
1061701914 9:132422596-132422618 ACCTGGAGCTTTGGGGAAAGAGG + Intronic
1061865788 9:133491156-133491178 ACTTGGAGGAGGAGGGAGGGAGG + Intergenic
1061916181 9:133755656-133755678 AGAGGGAGGGTGGGGGAGAGAGG + Intergenic
1062181877 9:135195293-135195315 ACATGGGTGATGGGAGAGAGAGG - Intergenic
1062255050 9:135616852-135616874 GCCTGGGGGACGGAGGAGAGAGG + Intergenic
1062345158 9:136111077-136111099 GCCTGGGGGATGGGGGAGGGTGG - Intergenic
1062354177 9:136154098-136154120 ACTGGGAGGATGGGAGAGACTGG - Intergenic
1062365799 9:136208351-136208373 CCCTGCAGGATGGGGCGGAGTGG + Exonic
1062415670 9:136448362-136448384 ACCAGGAGGATGGAGGTGGGGGG + Intronic
1062415681 9:136448399-136448421 ACCAGGAGGATGGAGGTGGGGGG + Intronic
1062415700 9:136448473-136448495 ACCAGGAGGATGGAGGTGGGGGG + Intronic
1062415763 9:136448731-136448753 ACCAGGAGGATGGAGGTGGGGGG + Intronic
1062415789 9:136448843-136448865 ACCAGGAGGATGGAGGTGGGAGG + Intronic
1203425081 Un_GL000195v1:30452-30474 CCCTGGAGGGAGGGGCAGAGCGG - Intergenic
1203425107 Un_GL000195v1:30588-30610 GCCTGGAAGAAGGGGCAGAGTGG - Intergenic
1203444403 Un_GL000219v1:41896-41918 CCCTGGAGGAAGGGTCAGAGTGG - Intergenic
1203444426 Un_GL000219v1:42032-42054 ACCTGGAAGAAGGGGCAGAGTGG - Intergenic
1203576934 Un_KI270745v1:16298-16320 ACCTCGAGGATGGGAGGCAGGGG - Intergenic
1185796863 X:2972864-2972886 ACCTGGGGTATGAGGGAGAGAGG + Intergenic
1186127463 X:6429436-6429458 AGCTGGAGAATGGGGAGGAGGGG + Intergenic
1186974750 X:14889595-14889617 ACATGGGGGTTGGGGGAGAGAGG - Intronic
1186976864 X:14917058-14917080 AACTGGGGGATGGGGTACAGTGG + Intronic
1187370900 X:18705302-18705324 ACCTGGAGGATGGTTTGGAGTGG + Intronic
1187500090 X:19832520-19832542 ACCTGAAGGAATGAGGAGAGAGG + Intronic
1188024789 X:25196732-25196754 AGATGGGGGATGGGTGAGAGTGG + Intergenic
1189021972 X:37350034-37350056 CCCTGGGGGATGGGAGAGCGGGG + Intronic
1189286739 X:39857142-39857164 ACCTGGGGGGAGGGGGAGAAGGG + Intergenic
1189643910 X:43105559-43105581 ACTTGGAGCCTGGGGGACAGAGG - Intergenic
1190154937 X:47982761-47982783 GCCTGGTGTATGGGGGACAGCGG + Intronic
1190265999 X:48827374-48827396 ACCTGGAGGACTGCGGGGAGGGG - Intergenic
1190414507 X:50167544-50167566 ATCTGGAGGGTGGAGGAGGGAGG + Intergenic
1190474644 X:50814199-50814221 AGCTGGAGAAAGGGGGAGAGAGG + Intronic
1190581200 X:51894255-51894277 GCCTGGGGGCTGTGGGAGAGGGG - Exonic
1190595375 X:52048109-52048131 ACCTGGAGGGAGGGGGAAACAGG - Intergenic
1190613449 X:52205964-52205986 ACCTGGAGGGAGGGGGAAACAGG + Intergenic
1191650085 X:63527903-63527925 AGCTGGAAGATGGTGGAGAGTGG + Intergenic
1191676265 X:63795239-63795261 AACAGGAGGATGAGGAAGAGAGG + Intergenic
1192082444 X:68061301-68061323 GACTGGAGGAAGGGGAAGAGGGG + Intronic
1192742961 X:73911388-73911410 ACCTGGGTGATGGAGGAAAGAGG + Intergenic
1194207854 X:91033049-91033071 TCTTGGAGGAAGGGGCAGAGAGG - Intergenic
1194983009 X:100459905-100459927 TCATGGAGGAGGGGGGAGAGAGG - Intergenic
1195742767 X:108081965-108081987 CCCTGGAGGATGGGGGGTTGGGG + Intergenic
1196320013 X:114275374-114275396 ACCTGGAGTTTGGGGGTGGGGGG - Intergenic
1197982695 X:132234357-132234379 AACTTGTGGATGAGGGAGAGAGG - Intergenic
1198560827 X:137848270-137848292 AGCTGGAATATGGGGGAGGGGGG + Intergenic
1199011027 X:142759130-142759152 AGCAGGAGGAAGGGAGAGAGAGG - Intergenic
1199429805 X:147746090-147746112 GCCTGGGAGATGGGGGAGTGGGG - Intergenic
1200142250 X:153908071-153908093 ACCTGGAGGCTGAGGGACTGGGG - Intronic
1200173831 X:154097861-154097883 ACGGGGAGGACGGGGGAGGGGGG + Intergenic
1200256050 X:154584096-154584118 ATTTGGAAGGTGGGGGAGAGTGG + Intergenic
1200261719 X:154620307-154620329 ATTTGGAAGGTGGGGGAGAGTGG - Intergenic
1201332892 Y:12846939-12846961 ACCGAAAGGATTGGGGAGAGGGG - Exonic
1201550758 Y:15214254-15214276 ACCTCAAGGAGGGAGGAGAGAGG + Intergenic
1202124407 Y:21555924-21555946 ATCTGGAGGAGTGGGGAAAGTGG + Intergenic
1202154601 Y:21873456-21873478 ATCTGGAGGAGTGGGGAAAGTGG - Intergenic