ID: 1015392771

View in Genome Browser
Species Human (GRCh38)
Location 6:132701793-132701815
Sequence TGTGGTAACCTGGAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392771_1015392781 7 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392771_1015392782 8 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392771_1015392783 9 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392771_1015392784 13 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392771_1015392780 6 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392771 Original CRISPR TGTGGTAACCTGGAGGATGG GGG (reversed) Intronic
900181597 1:1313469-1313491 TGTGGGAATCTGGAAGCTGGAGG - Intronic
900977307 1:6025741-6025763 TGTTGTCACCTGTAGCATGGGGG + Intronic
901656389 1:10772149-10772171 TCTGGTTGCCTGGAGGAAGGAGG + Intronic
903885564 1:26539158-26539180 TGTGGGCACCTGGAAGGTGGTGG - Intronic
904421746 1:30398524-30398546 TGAGGTGACCTGGGGGTTGGGGG + Intergenic
904550265 1:31310816-31310838 TCTGGGAACCTGCAGGATAGTGG - Intronic
905204080 1:36332998-36333020 TGGGGTAACAAGGAGGAGGGGGG - Intergenic
905513436 1:38542719-38542741 GGTAGCAACCTGGAGGAGGGTGG + Intergenic
905990984 1:42336605-42336627 TGAGGAAAACTGGAGGAAGGGGG + Intergenic
907327432 1:53648811-53648833 TGTGGTTACCTTGAAGAAGGAGG + Intronic
908216847 1:61962818-61962840 TGAGGTGACATGGAGGATGGAGG - Intronic
908395874 1:63725278-63725300 TGAAGTCACCTGGGGGATGGTGG - Intergenic
908709858 1:67002931-67002953 TGGGGTAATCTGGAGGGTGGAGG - Exonic
909603676 1:77487166-77487188 TGAGATAACCTGGAGCATAGTGG - Intronic
910370488 1:86510429-86510451 TGTGGTCTACTTGAGGATGGAGG + Intergenic
912694756 1:111832892-111832914 GGTGGTGAGCTGGAGGAGGGAGG - Intronic
913288821 1:117253084-117253106 TGTGGTTTCCTGGCAGATGGGGG - Intergenic
914730402 1:150364699-150364721 TGTGCAAACCGGGAAGATGGCGG + Exonic
915466911 1:156103501-156103523 GGTGGGAACCTTAAGGATGGTGG + Intronic
915734695 1:158077419-158077441 TGGGGGAGCCTGGAGGAAGGAGG + Intronic
915947726 1:160166184-160166206 TGCTTTAACCTGGGGGATGGAGG + Intronic
916865473 1:168851966-168851988 TAGGGTAACCTGGAGGTTGGAGG - Intergenic
917230853 1:172835943-172835965 GGTGGTGACCCTGAGGATGGTGG - Intergenic
917630162 1:176883709-176883731 TGTGGTCACCAGCAGGATGATGG - Intronic
918782713 1:188723258-188723280 TGTTTGAACCTGGCGGATGGGGG - Intergenic
920309302 1:205039232-205039254 TGTGCTAAACAGGAGGGTGGGGG + Intergenic
920611598 1:207444687-207444709 TGGGGTGGTCTGGAGGATGGGGG - Intergenic
920846217 1:209595220-209595242 TTTTGTGGCCTGGAGGATGGTGG + Intronic
921356441 1:214288522-214288544 TGTGGTTCCCTGGAGACTGGGGG + Intronic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
922267974 1:224004952-224004974 TGTCGTGGCATGGAGGATGGGGG - Intergenic
922850228 1:228726849-228726871 TGTGATCACCTGGAAGATGAGGG + Intergenic
923373102 1:233332302-233332324 AGTGGTAGAGTGGAGGATGGGGG + Intronic
1063407491 10:5811448-5811470 TGTGGAAGCCTGCATGATGGTGG + Intronic
1063427316 10:5960358-5960380 AGTGCTAACCTGGCGGCTGGTGG + Exonic
1063954554 10:11254390-11254412 TTTGATAACGTGGATGATGGAGG + Intronic
1065108031 10:22410378-22410400 TGTGGTAAGCACGTGGATGGTGG + Intronic
1066253255 10:33654391-33654413 TGTGTTAACCTGGGAGGTGGAGG + Intergenic
1067226427 10:44379210-44379232 TGAGGAAGCCTGGAGGAAGGAGG + Intronic
1069708630 10:70475150-70475172 TGTGGTAACTTGTAGCATAGGGG + Intergenic
1069918007 10:71798992-71799014 TGTGGTCACTTGAAGGAGGGTGG - Intronic
1070826583 10:79393816-79393838 CTTGGGGACCTGGAGGATGGGGG - Intronic
1072744421 10:97929783-97929805 TGTGATTTCCTGGATGATGGTGG - Intronic
1072791489 10:98321383-98321405 GGTTGTAACCTGAAGGATGTGGG - Intergenic
1074527503 10:114275035-114275057 TGTGAGAATCTGGAGCATGGAGG + Intronic
1074698921 10:116076099-116076121 TGTGGTCCCATGGAGAATGGAGG - Intronic
1075440099 10:122473287-122473309 TGAGGTGACCTGAAGGCTGGAGG + Intronic
1075999187 10:126902199-126902221 TGTTGTATCTTGGAGGAGGGGGG + Intergenic
1076515720 10:131043427-131043449 GGATGCAACCTGGAGGATGGAGG - Intergenic
1077223560 11:1427813-1427835 GGCCGTAGCCTGGAGGATGGGGG - Intronic
1081786216 11:45749751-45749773 TCTGGTACCCTGGAGGTGGGTGG + Intergenic
1082225632 11:49703282-49703304 TGTGGTGAACTGGGGGATGGGGG + Intergenic
1083042851 11:59704764-59704786 TGTGGAAACCTGGAATATAGTGG - Intergenic
1083232825 11:61333762-61333784 TGGGGTACCCTGGAGGCTGCAGG - Intronic
1083358556 11:62087082-62087104 TGTTTGAACCTGGGGGATGGAGG - Intergenic
1085038610 11:73314033-73314055 TGTGGGAAATTGGAGGATGATGG - Intronic
1085778311 11:79385849-79385871 TGTGGTAACTTGGAGGGAGGAGG - Intronic
1086623448 11:88916300-88916322 TGTGATGAACTGGGGGATGGGGG - Intronic
1089787958 11:120921609-120921631 TGTGGGAGCCAGGAGGGTGGAGG - Intronic
1093146252 12:15570233-15570255 TATAGAAACCTGAAGGATGGGGG - Intronic
1096707315 12:53430304-53430326 TCTGGGAACCTGGAGAGTGGGGG + Intronic
1098568729 12:71964940-71964962 TGGGGTCTCCTGGAGGGTGGAGG - Intronic
1099080742 12:78177237-78177259 TGGGGTAACTTGGGGGATGCCGG - Exonic
1100637261 12:96446588-96446610 TGTGGTAACCTGGATTTTGCTGG + Intergenic
1101625247 12:106434398-106434420 TGTGTTAACTTGGAGGTAGGTGG + Intronic
1101824496 12:108209895-108209917 TGTGGAGACCTGGGAGATGGGGG - Intronic
1101945183 12:109131084-109131106 TGTGGCAAGCTGGAGGGAGGTGG + Intronic
1103109640 12:118264537-118264559 AGTGGTTACCTGGGGGAAGGGGG + Intronic
1104955282 12:132461893-132461915 TGTGCTCGCATGGAGGATGGTGG - Intergenic
1106681694 13:32014850-32014872 TGTGGTAACCAGCAGGCTGGTGG - Intergenic
1107602242 13:42025311-42025333 TTTGGCAACATGGAGGATGCTGG + Intergenic
1108557423 13:51608331-51608353 AGTGGTAACCTATAGGATGCAGG - Intronic
1109503391 13:63267583-63267605 TGTGGGGGTCTGGAGGATGGTGG + Intergenic
1109591529 13:64490312-64490334 TGTGGTAACATGGTAGAAGGAGG - Intergenic
1110348279 13:74475091-74475113 TTTGGTATCCTGCAGGGTGGGGG + Intergenic
1116637990 14:47422401-47422423 TTTGTTAACCTGGAAGCTGGAGG - Intronic
1118367777 14:65110254-65110276 TTTGGTAACTGAGAGGATGGTGG - Intergenic
1118477044 14:66127268-66127290 TGTGCTCACTTGGAGGCTGGGGG + Intergenic
1119722360 14:76899815-76899837 TGAGCTCACCTGGATGATGGGGG - Intergenic
1119854971 14:77892824-77892846 TGTGTTAGCCAGGATGATGGGGG + Intronic
1122506820 14:102236862-102236884 TTTTTTAACCAGGAGGATGGTGG - Intronic
1123942084 15:25221555-25221577 TGGGGTCACCTCCAGGATGGCGG + Intergenic
1127917575 15:63467746-63467768 TGTGGGATCCTGGAGGCTGCTGG - Intergenic
1130073863 15:80671898-80671920 TCTGGTAAGCAGGAGGAAGGAGG - Intergenic
1131046582 15:89320371-89320393 TGTGGCAAACTGGAGCATGTAGG - Intronic
1131224341 15:90611581-90611603 TGCGGTGACCAGAAGGATGGTGG - Intronic
1131835753 15:96388971-96388993 TGTGGAAACCTGGGGTGTGGTGG + Intergenic
1133056895 16:3149879-3149901 TGAGGAAACCGGGGGGATGGGGG - Exonic
1133545799 16:6805376-6805398 TGGGGTCTCCTGGAGGATAGAGG + Intronic
1134805491 16:17120518-17120540 TGAGGTGGCCTGGAGGATGCGGG - Intronic
1136080922 16:27852231-27852253 GGTGGGGACCTGGAGGATGCTGG + Intronic
1136537987 16:30911483-30911505 GGTGGTAACCTGGAGGCAGAGGG + Intergenic
1136586221 16:31186998-31187020 TGTGCTAACCTGGAGCAGGTAGG + Intronic
1138593541 16:58016737-58016759 TTTGGTAACGTGGAGGTTGTTGG + Intronic
1141090673 16:81128336-81128358 TGTGGTGACCAGTGGGATGGAGG - Intergenic
1141222981 16:82089134-82089156 AGTGGTTACCTGAAGGGTGGGGG - Intronic
1142409358 16:89908186-89908208 GGTGGGAACTTGGAGGAGGGAGG - Intronic
1144034448 17:11353047-11353069 AGTGGTAAAATGGAGGTTGGGGG - Intronic
1144589755 17:16514186-16514208 TGTGGTATACTGAAGGAAGGGGG - Intergenic
1144605150 17:16658301-16658323 TTTGGGAGTCTGGAGGATGGTGG + Intergenic
1144682553 17:17205432-17205454 TCTGGTAACCTGGATCCTGGTGG - Intronic
1144778927 17:17798304-17798326 TGTGATGGCCGGGAGGATGGGGG + Exonic
1145783149 17:27577304-27577326 TCTGGGAGCCTGGAGGGTGGGGG + Intronic
1146693715 17:34893450-34893472 TGTGGGAAAGTGGAGGATGGAGG - Intergenic
1147326524 17:39672353-39672375 AGTGGTGTCCTGGAGGAGGGTGG + Exonic
1147933541 17:43997817-43997839 GGTGGTATCCTGGAGGAGGTGGG + Intronic
1148446479 17:47740935-47740957 TCAGGAAACCTGGAGGAGGGAGG - Intronic
1148507161 17:48136552-48136574 TGAGGTAACCTTGAGAATGTTGG + Intronic
1149462829 17:56846464-56846486 TGTTCTAAACTGGATGATGGTGG + Intronic
1149899096 17:60457307-60457329 AGTGGTTACCTGGAGGGTGGGGG - Intronic
1151320426 17:73349296-73349318 TGTGTTCATCTAGAGGATGGAGG - Intronic
1151595729 17:75077180-75077202 TGCAGTAACCTGGCGGGTGGAGG - Intergenic
1152310297 17:79545763-79545785 TGTGAGAACCTGGAGCAGGGTGG - Intergenic
1152387685 17:79984899-79984921 TGTCCGAAGCTGGAGGATGGTGG - Intronic
1153348322 18:4052141-4052163 TTTGGGAGTCTGGAGGATGGTGG + Intronic
1154975225 18:21451009-21451031 GGTGCTGACCTGCAGGATGGAGG - Exonic
1156161219 18:34360422-34360444 TGTGGGAACCAGTCGGATGGAGG + Intergenic
1156293922 18:35773289-35773311 TGGGGACACCTGGAGGATGGAGG - Intergenic
1156874618 18:41993812-41993834 CGTGGTAACTTGGATGATGGTGG + Intronic
1159916051 18:74188813-74188835 AGTGGAAACAGGGAGGATGGTGG - Intergenic
1160437522 18:78862876-78862898 TGAGATCACCTGGAGGGTGGGGG + Intergenic
1166637191 19:44460774-44460796 GGTGTGAACCTGGAAGATGGAGG + Intergenic
1166971498 19:46571617-46571639 TGTGCTGCCCTGGAGGAAGGTGG - Intronic
1167014849 19:46834500-46834522 TGCTGGAACCTGGAGGGTGGAGG - Intergenic
1168371786 19:55841423-55841445 TGTGGCAACCTGGATGAACGTGG - Intronic
925336104 2:3100518-3100540 TGTGGTTTCCTGGAGGAGGGTGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926731899 2:16041871-16041893 TGTGGTTGGCTGGAGGAGGGTGG + Intergenic
929804200 2:45130336-45130358 AGTGGTAACTTGGATGTTGGTGG - Intergenic
934015876 2:87881264-87881286 TCTGGGGGCCTGGAGGATGGTGG + Intergenic
935175069 2:100642281-100642303 TGTGCCACCCTGGGGGATGGAGG + Intergenic
936048465 2:109204584-109204606 TGCCGGCACCTGGAGGATGGAGG - Intronic
937309033 2:120890801-120890823 TATGCTTACCTGGAGGCTGGTGG + Intronic
937439490 2:121904078-121904100 TGTGGGACCCAGCAGGATGGTGG + Intergenic
937857188 2:126680931-126680953 AGTGGGAACCTGGAGCAAGGCGG + Intronic
938094952 2:128455604-128455626 TGTGGGAGCCTGGAGGCTGGAGG - Intergenic
939484462 2:142792768-142792790 TGTGGTCTACTTGAGGATGGAGG + Intergenic
940012016 2:149064745-149064767 TTTGGGGACCTGGAGGCTGGTGG + Intronic
940017064 2:149117938-149117960 TGTGGTCATCTGAAGGCTGGAGG + Intronic
940371905 2:152912045-152912067 TGTGTGAACCTGGAAGGTGGAGG - Intergenic
940561357 2:155301357-155301379 TATCATATCCTGGAGGATGGTGG - Intergenic
941678555 2:168370743-168370765 TGGGCTCACCTGGATGATGGAGG - Intergenic
941888992 2:170558452-170558474 GGTGGTTACCTGTAGGATGCAGG - Intronic
944993164 2:205261348-205261370 GGTGGTATCTTGGAGGATGTGGG - Intronic
947645063 2:231732745-231732767 TCTGGTCAGCTGGAAGATGGTGG + Exonic
947904552 2:233750990-233751012 TTTGGGATTCTGGAGGATGGTGG - Intronic
948176650 2:235948787-235948809 TGTGGCAAGTGGGAGGATGGGGG - Intronic
1168742622 20:206051-206073 TGGGGTATCCTTGAGGGTGGAGG + Intergenic
1169106305 20:2998140-2998162 TCTGGTAGCCAGGAGGCTGGAGG - Intronic
1169940230 20:10928933-10928955 TGTGGTAACTTGGGAGGTGGTGG - Intergenic
1171253508 20:23668538-23668560 TGTGGTGAAGTGGAGGATGCCGG - Intergenic
1171269057 20:23799365-23799387 TGTGGTGAAGTGGAGGATGCAGG - Intergenic
1172307144 20:33888897-33888919 TGGGTTAACATGGAGGAGGGAGG + Intergenic
1172390921 20:34564824-34564846 TGTGGAAATCTGGAGGATAAAGG + Intronic
1173300090 20:41794649-41794671 TGTGATCACCTGGAGGATGCAGG + Intergenic
1175290281 20:57870796-57870818 TCTGGTGACCTGGAAGTTGGGGG - Intergenic
1175722206 20:61294190-61294212 TGGGCTGACCTGGAGGCTGGGGG + Intronic
1175733707 20:61371250-61371272 GGTGGGCACCTGCAGGATGGAGG + Intronic
1175764919 20:61585693-61585715 TGTGGTCATGTGGAGGATGGTGG + Intronic
1176142858 20:63552948-63552970 TGGGGTCACCGGGAGGAGGGGGG + Intronic
1177608142 21:23408576-23408598 TGTGGAAACTTGGAGGATGGGGG + Intergenic
1180021107 21:45127671-45127693 AGTGGGAACCTGGAGGAAGGAGG - Intronic
1183733160 22:39629494-39629516 TGTGATAAACCGGAAGATGGTGG - Intronic
1184607253 22:45581273-45581295 AGTGGTGATCTGGAGGCTGGAGG - Intronic
1185207410 22:49548051-49548073 TGTGGGACCCTGGAGGGAGGCGG - Intronic
951881815 3:27486913-27486935 TGCTTGAACCTGGAGGATGGAGG - Intergenic
952807938 3:37375056-37375078 TTTTGGGACCTGGAGGATGGCGG + Intergenic
953352251 3:42224013-42224035 TGTGCTAACCTGGGGGAAGGTGG + Exonic
954053178 3:47999683-47999705 TGGGGTCTCCTGGAGGGTGGAGG + Intronic
956701203 3:71960454-71960476 TGTGCTCCCCTGAAGGATGGAGG + Intergenic
956880944 3:73510021-73510043 TGTCGTACACTGGAGGTTGGGGG + Intronic
959591315 3:108084904-108084926 TGGAGAAACCTTGAGGATGGAGG - Intronic
961794947 3:129402741-129402763 TGTGTTCCCCTGGAGCATGGAGG - Intronic
964004429 3:151811371-151811393 TGGGGTGACAAGGAGGATGGGGG - Intergenic
964130499 3:153281380-153281402 TGTGCTCGCCTGGAGGCTGGAGG + Intergenic
966302486 3:178495104-178495126 CCTGGGCACCTGGAGGATGGAGG - Intronic
966700017 3:182839265-182839287 TGGGGCATACTGGAGGATGGAGG + Intronic
967001722 3:185342128-185342150 TGTAGTCACCTGAAGGCTGGAGG - Intronic
967974563 3:195025842-195025864 TGTGGCAAGCTGGAGGGAGGGGG + Intergenic
968589944 4:1452528-1452550 TGTGGTGACAGTGAGGATGGAGG - Intergenic
969031399 4:4217895-4217917 TGTGGAAAGCTGGAGGAGGGTGG + Intronic
971097832 4:23428125-23428147 TGTGGTAGCCAGGAGTATGCTGG - Intergenic
972833684 4:42843080-42843102 TGTGGGAAGCTGGTGGAAGGTGG + Intergenic
974762436 4:66294756-66294778 TGTGGGAACCTGGATGAAGCTGG - Intergenic
974875675 4:67700768-67700790 TCTGGTGACTTGGAGGAAGGAGG + Intronic
976048052 4:80976512-80976534 TGTTGTAAGCTGGGGGAGGGAGG + Intergenic
977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG + Intronic
977863326 4:101993468-101993490 TGTGGTAAACTGGGGCGTGGAGG + Intronic
978409944 4:108415813-108415835 TGTAGTAAACTGGAGGTGGGAGG - Intergenic
979373215 4:119914216-119914238 TCTGGGGATCTGGAGGATGGTGG + Intergenic
980608458 4:135124170-135124192 TGTGGGATCCTGGAAGATGAAGG - Intergenic
981008689 4:139902352-139902374 TGTTGTGAAATGGAGGATGGAGG - Intronic
982105300 4:152006701-152006723 TGAGGTGACCTTGAGGATGAAGG + Intergenic
982559132 4:156907811-156907833 TTTGGTGACCTGGAGTGTGGGGG - Intronic
984056322 4:174933631-174933653 TGGGGTCTCCTTGAGGATGGAGG - Intronic
985579058 5:687209-687231 TCTGGTCTCCAGGAGGATGGGGG + Intronic
986004698 5:3657946-3657968 TCTGGAAACCTGCAGGAAGGAGG + Intergenic
988636050 5:32986197-32986219 TGCGGTAACCTGGATGAGGTTGG + Intergenic
988659525 5:33250208-33250230 TGCAGTAATCTGGATGATGGTGG + Intergenic
988835572 5:35029062-35029084 TTTGGTTAGCTGGAGGTTGGAGG + Intronic
990225664 5:53649501-53649523 TGTGGCAACATGGATGAAGGTGG - Intronic
990347971 5:54887684-54887706 TGTGGACAGCTGGAGGATGCTGG - Intergenic
992953947 5:81889020-81889042 AGAGATAACCTGGATGATGGTGG + Intergenic
992992977 5:82304150-82304172 TGTGGATGACTGGAGGATGGAGG - Intronic
994119942 5:96102203-96102225 TGAAGTCACTTGGAGGATGGTGG + Intergenic
995348015 5:111143071-111143093 TGTGGCGACCTTGAGGTTGGAGG + Intergenic
997242085 5:132315050-132315072 TGTTGGAAACTGGAGGTTGGAGG + Intronic
998147785 5:139740108-139740130 GGTGGTAAGGTGGAGGATTGAGG + Intergenic
999306728 5:150524376-150524398 TGTGAGATCCTGGAGGGTGGTGG + Intronic
1002426906 5:179181968-179181990 GGTGGGAAGCTGGAGGGTGGGGG - Intronic
1002889978 6:1324015-1324037 TGTGCCCAGCTGGAGGATGGAGG + Intergenic
1003130719 6:3393133-3393155 TGTGGCAGCCTGGAGGCTGTGGG + Intronic
1004022473 6:11787955-11787977 TGGGGTGACAAGGAGGATGGGGG - Intronic
1006940059 6:37746013-37746035 TGAGGTAACCTTGGGAATGGAGG + Intergenic
1007090187 6:39179399-39179421 TGTGGGAGCCTGGAGGCTGGAGG - Intergenic
1007760354 6:44129546-44129568 TGTGGTAGCCTGGGAGGTGGAGG - Intronic
1015392771 6:132701793-132701815 TGTGGTAACCTGGAGGATGGGGG - Intronic
1016838327 6:148501775-148501797 TGTGGCAACCTGCAGAATTGGGG + Intronic
1017636666 6:156450754-156450776 TGTGGTGTCCTGGAGTATGGAGG - Intergenic
1017906660 6:158761237-158761259 TGTGGAAAGCAGGAGGGTGGAGG + Intronic
1018839003 6:167505836-167505858 AATGGCAACCTGGAGGATGAAGG - Intergenic
1019162126 6:170075843-170075865 TGAGGGCACCTGGAGGCTGGGGG - Intergenic
1019205338 6:170357009-170357031 TGTGCTCCCCTGGAGGATGGCGG - Intronic
1020973731 7:14980587-14980609 AGTGGCAACCTGGAGGATGCAGG + Intergenic
1021360443 7:19706442-19706464 TGTGGTCCCCTGGTGGAAGGGGG + Intronic
1022985225 7:35647327-35647349 TGAGGGAGCCTGGAGGAGGGTGG - Intronic
1024565067 7:50673939-50673961 TGTGGAAACAGGGAGGCTGGAGG - Intronic
1024866959 7:53914013-53914035 TGTGGTTACCTGGAAGCTGTGGG - Intergenic
1025709967 7:63899958-63899980 TGTGACAACCCAGAGGATGGAGG + Intergenic
1027459723 7:78437058-78437080 TGTGGGAGCCTGGAGGATGCAGG + Intronic
1028669550 7:93385979-93386001 TGTGGAAACACAGAGGATGGAGG + Intergenic
1029172647 7:98641826-98641848 TGTGGTCACCTGCAGGACCGGGG - Intergenic
1030065181 7:105653870-105653892 AGTGTTCACCTGGAGAATGGGGG - Intronic
1031084577 7:117289899-117289921 AGTGGTACCCGGGATGATGGAGG + Intronic
1033443193 7:141398327-141398349 TCTGGGAACATTGAGGATGGAGG + Intronic
1033653462 7:143359043-143359065 TGTGATATTCTGGAGGATGTGGG - Intronic
1036557616 8:9873990-9874012 TGAGCTGCCCTGGAGGATGGTGG + Intergenic
1037841469 8:22248278-22248300 TGTGGGTACCAGGAGGCTGGGGG + Exonic
1042849471 8:73202178-73202200 TCTGGAAACCTGGAGAAAGGAGG + Intergenic
1043150561 8:76709690-76709712 TGTGGGAACCTAAAGGAAGGTGG + Intronic
1043665601 8:82807965-82807987 TATGGTTGCCTGGAGGAGGGAGG + Intergenic
1046878019 8:119277596-119277618 TGTGGTGGTCTGGAGGATGGAGG + Intergenic
1047101264 8:121678700-121678722 TGCAGTATCCTGGAAGATGGTGG + Intergenic
1047255864 8:123213027-123213049 AGTGCTCACCTGGAGGGTGGAGG - Intergenic
1047358421 8:124144943-124144965 TGTGGGAAAAGGGAGGATGGTGG + Intergenic
1048225052 8:132577144-132577166 AGTGGTAGCCTCCAGGATGGTGG - Intronic
1048303378 8:133267253-133267275 TTAGGTAACCTTGAGGAGGGCGG - Intronic
1049581503 8:143413240-143413262 TCTGGTGACCTGGCGGAGGGTGG - Intergenic
1049855048 8:144856463-144856485 TGAGGTAACCAGGAAGATGGAGG - Intergenic
1051648813 9:19299445-19299467 TTTGGTAACTGGGTGGATGGTGG + Intronic
1051881151 9:21841059-21841081 TGTGGGAAATTGGGGGATGGGGG - Intronic
1056565320 9:87766927-87766949 TGACATCACCTGGAGGATGGGGG + Intergenic
1056592660 9:87975934-87975956 TGTGGTTACCTGGTGGAAGAGGG + Intergenic
1057485881 9:95483747-95483769 TGTGGCTAGGTGGAGGATGGCGG - Intronic
1058774325 9:108268910-108268932 TTAGGAAACCTGGAGAATGGAGG + Intergenic
1059045513 9:110861952-110861974 TTTTGTCATCTGGAGGATGGTGG - Intergenic
1059592282 9:115674744-115674766 TTTGGTATACTCGAGGATGGAGG + Intergenic
1059795970 9:117697205-117697227 TGTCGTAACTTGGGGGTTGGAGG - Intergenic
1059843291 9:118242804-118242826 TTTGGGGGCCTGGAGGATGGTGG + Intergenic
1060111508 9:120909941-120909963 TGGGGTCCCCTGGAGGCTGGGGG + Intronic
1060586937 9:124792536-124792558 TGTGCTGGCCTGGAGGAGGGTGG + Intronic
1061048602 9:128180889-128180911 TGTCATCCCCTGGAGGATGGGGG - Intronic
1061373844 9:130212701-130212723 TGTGGGAACCTGCAGGAGTGGGG + Intronic
1061739579 9:132691118-132691140 TGTGGAAACCTGGGGGAGGCAGG - Exonic
1061878057 9:133554690-133554712 CGAGGTAACCAGGAGGAGGGAGG + Exonic
1185482681 X:459474-459496 TGTGAAAACCTGGATGTTGGGGG + Intergenic
1186505795 X:10091111-10091133 TTTGGTATCCTGAGGGATGGGGG - Intronic
1188138072 X:26514449-26514471 TGTGGGAACCTGGAGTCTAGTGG + Intergenic
1190405192 X:50079771-50079793 GGTGGTTACCTGGGGCATGGAGG + Intronic
1192253761 X:69436902-69436924 TGTGGTAACATGGATGAAGCTGG - Intergenic
1192887603 X:75352159-75352181 TGTGGTAATTTGGAGGAAGGAGG + Intergenic
1194322685 X:92471264-92471286 TGGGGTCTCTTGGAGGATGGAGG - Intronic
1195556964 X:106237930-106237952 TGTGGTGACCTGGATGAGGTTGG + Intergenic
1198928530 X:141826094-141826116 TCTGGTAACTTGTAGGTTGGTGG + Intergenic
1199059126 X:143332298-143332320 TGTGGTCACATGGAGGAAGTTGG + Intergenic
1199128616 X:144157282-144157304 TCTGGGGGCCTGGAGGATGGTGG - Intergenic
1199384975 X:147213451-147213473 TGTGGTGTCCCTGAGGATGGGGG - Intergenic
1199386166 X:147225813-147225835 TGTGGTGTCCCTGAGGATGGGGG - Intergenic
1200397239 X:155998421-155998443 TGTGATGAGCTGGAGGATGTGGG + Intronic
1200630836 Y:5584742-5584764 TGGGGTCTCTTGGAGGATGGAGG - Intronic
1201448501 Y:14084070-14084092 GGTGGTACCATGGGGGATGGTGG + Intergenic