ID: 1015392772

View in Genome Browser
Species Human (GRCh38)
Location 6:132701794-132701816
Sequence ATGTGGTAACCTGGAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392772_1015392787 30 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392772_1015392783 8 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392772_1015392784 12 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392772_1015392782 7 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392772_1015392780 5 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392772_1015392781 6 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392772 Original CRISPR ATGTGGTAACCTGGAGGATG GGG (reversed) Intronic
901667196 1:10832921-10832943 ATGAGGTCACCTGGCAGATGGGG + Intergenic
901849205 1:12004747-12004769 CTGGGGTCACCTGGTGGATGTGG + Intronic
903778000 1:25805516-25805538 ATCTGGTAGACTGCAGGATGAGG + Intronic
904066172 1:27753097-27753119 TTGTGGTGAGCTGGAGGTTGTGG + Intronic
905036249 1:34919872-34919894 ATGGGGAGACCTGGAGGAAGGGG - Intronic
905310621 1:37046528-37046550 GTCAGGGAACCTGGAGGATGGGG - Intergenic
905990983 1:42336604-42336626 ATGAGGAAAACTGGAGGAAGGGG + Intergenic
908186191 1:61655108-61655130 ATGTGGCACCCTGGATTATGAGG + Intergenic
910749413 1:90612501-90612523 ATGTGCTAGCCAGGAAGATGTGG + Intergenic
913174943 1:116264955-116264977 ATATGGGAGCCTGGAGGCTGAGG + Intergenic
913288822 1:117253085-117253107 ATGTGGTTTCCTGGCAGATGGGG - Intergenic
915415472 1:155739054-155739076 ATGTTGCTACCTGGAGGAAGTGG + Intergenic
917871870 1:179249314-179249336 ACGTGGGAATCTGGAGGAAGGGG + Intergenic
922190734 1:223316447-223316469 ACATGGGAACCTGGAGGAAGGGG + Intronic
922850227 1:228726848-228726870 TTGTGATCACCTGGAAGATGAGG + Intergenic
923176602 1:231472511-231472533 AAGCTGTACCCTGGAGGATGTGG + Intergenic
923358597 1:233185026-233185048 AACAGGTAACCTGGAGAATGAGG - Intronic
1062929833 10:1345406-1345428 TTCTGGGAAGCTGGAGGATGTGG - Intronic
1063929212 10:11012499-11012521 ATGTGGTAAGCTTGAGGGTGGGG - Intronic
1065686860 10:28294189-28294211 ATGTTTTAAACTGGAGGCTGAGG + Intronic
1067016152 10:42757468-42757490 TTGTGATAACCTGGAAGAGGGGG + Intergenic
1069708629 10:70475149-70475171 ATGTGGTAACTTGTAGCATAGGG + Intergenic
1069736828 10:70662021-70662043 AGGGCGTATCCTGGAGGATGAGG + Intergenic
1070826584 10:79393817-79393839 ACTTGGGGACCTGGAGGATGGGG - Intronic
1071135419 10:82447786-82447808 ATGTGGTATTCTAGTGGATGGGG + Intronic
1072791490 10:98321384-98321406 GGGTTGTAACCTGAAGGATGTGG - Intergenic
1073314995 10:102573662-102573684 ATGTTGTAGCCTGCAGCATGTGG - Intronic
1074026626 10:109642481-109642503 ATGTGATAAGCTGGAGAAGGAGG + Intergenic
1074100497 10:110350931-110350953 GTGAGGTAACTTGGAGGATCAGG - Intergenic
1075874586 10:125795789-125795811 ATGTGGTGACTTTGAGGAAGTGG - Intronic
1076034018 10:127184034-127184056 CTCTGGTAATCTGGAGGAGGAGG + Intronic
1076446558 10:130518200-130518222 ATGTGCGAACCTGGAAGATGAGG + Intergenic
1076741430 10:132487711-132487733 ATGTGGAACCCTGGAGGTGGAGG - Intergenic
1077914941 11:6605078-6605100 ATGGAGAAAACTGGAGGATGAGG + Intronic
1078580207 11:12533777-12533799 ATGTGATGACCATGAGGATGAGG - Intergenic
1082225631 11:49703281-49703303 TTGTGGTGAACTGGGGGATGGGG + Intergenic
1083477801 11:62925408-62925430 CTGTGGTTTCATGGAGGATGAGG + Intergenic
1086124790 11:83339319-83339341 ATCTGGAAACCTGGGGGAAGAGG + Intergenic
1086819847 11:91422327-91422349 ATTTGGTAACTTAGAGGAAGAGG + Intergenic
1090153245 11:124407559-124407581 ATGGGGTAACCTGGATGACCTGG - Intergenic
1093114222 12:15189845-15189867 AAGTGATAACCAGGAGGCTGTGG - Intronic
1097335623 12:58379719-58379741 AAGTGAAAACCTGGAGGGTGAGG + Intergenic
1097806081 12:63966611-63966633 ATTTGGTAACTTGGGGGGTGAGG + Intronic
1098490082 12:71065235-71065257 TTGAGGTAAACAGGAGGATGGGG + Intronic
1104428246 12:128695732-128695754 ATGTGGTCTCCTTGAGGTTGAGG + Intronic
1107301163 13:38967139-38967161 ATGTGGCAACATGGGGGCTGGGG - Intronic
1109623094 13:64935765-64935787 AGGTGGTAACTTGAAGGATAAGG - Intergenic
1111803051 13:93003842-93003864 ATGTGGTTTCCTGGAAGATTGGG + Intergenic
1113628586 13:111864694-111864716 ACATGGAAGCCTGGAGGATGCGG + Intergenic
1114069314 14:19095332-19095354 TTGTGATAACCTGGAGGAGGGGG - Intergenic
1114092947 14:19304670-19304692 TTGTGATAACCTGGAGGAGGGGG + Intergenic
1116710647 14:48364003-48364025 ATGTGGTCACCTAGAGGAGAGGG + Intergenic
1118477043 14:66127267-66127289 ATGTGCTCACTTGGAGGCTGGGG + Intergenic
1124336689 15:28862465-28862487 ATGGTGTGAACTGGAGGATGGGG + Intergenic
1126899548 15:53299508-53299530 CTGGGGCAACCTAGAGGATGTGG - Intergenic
1127027324 15:54821411-54821433 ATGTGGTTACCTGGATAAAGTGG - Intergenic
1129692983 15:77724177-77724199 ATGGGGGTACCTGGAGGAAGCGG - Intronic
1130217758 15:81988226-81988248 GTATGGTAAACTGGAGGAAGAGG + Intergenic
1130484383 15:84390505-84390527 ATCTGCTACCCTGGAGGATCTGG + Intergenic
1130919065 15:88328939-88328961 ATGTGGGCACCTGGAGGAAGAGG + Intergenic
1132265952 15:100470761-100470783 ATGTGGAAACTTAGAGGATCAGG + Intronic
1133056896 16:3149880-3149902 ATGAGGAAACCGGGGGGATGGGG - Exonic
1134510496 16:14842691-14842713 TGGTGGTCACCTGGAGGGTGGGG - Intronic
1134698136 16:16241179-16241201 TGGTGGTCACCTGGAGGGTGGGG - Intronic
1134805492 16:17120519-17120541 TTGAGGTGGCCTGGAGGATGCGG - Intronic
1134973701 16:18553498-18553520 TGGTGGTCACCTGGAGGGTGGGG + Intronic
1136059300 16:27714086-27714108 ATGTGAAAAACTGGAGGAAGAGG - Intronic
1136537986 16:30911482-30911504 AGGTGGTAACCTGGAGGCAGAGG + Intergenic
1139001627 16:62518037-62518059 AAGTGCTAACCTTGAAGATGAGG + Intergenic
1140405174 16:74705307-74705329 ATTAGGTAACCTAGAGGATATGG + Intergenic
1142694122 17:1623910-1623932 AGGTGGAAGCCTGGAGGTTGAGG - Intronic
1144034449 17:11353048-11353070 AAGTGGTAAAATGGAGGTTGGGG - Intronic
1144457060 17:15427548-15427570 ATGCAGAGACCTGGAGGATGTGG + Intergenic
1144589756 17:16514187-16514209 ATGTGGTATACTGAAGGAAGGGG - Intergenic
1147933540 17:43997816-43997838 GGGTGGTATCCTGGAGGAGGTGG + Intronic
1149899097 17:60457308-60457330 TAGTGGTTACCTGGAGGGTGGGG - Intronic
1150148475 17:62790890-62790912 AAGTGGTCACCTGCAGGAAGTGG + Intronic
1151254593 17:72866138-72866160 AGGTGGTAACGTGAACGATGGGG - Intronic
1151560814 17:74868673-74868695 AGGAGGAAACCTGGAAGATGAGG - Intronic
1153752913 18:8251981-8252003 ATGAGTTAACCTGTAGAATGTGG + Intronic
1154382344 18:13863895-13863917 AAGTGGCAACCTGGGGCATGGGG + Intergenic
1156748679 18:40423538-40423560 ATGCTGTAATCTGGAAGATGTGG + Intergenic
1158491846 18:57916902-57916924 ATGTGGGAACATGGAGTAAGAGG + Intergenic
1159919097 18:74211800-74211822 AGGTGGTCACCTGGAAGCTGAGG + Intergenic
1161396835 19:4049089-4049111 GTGTGCTACTCTGGAGGATGAGG - Intronic
1161895153 19:7074683-7074705 AGGTGGAAACCAGGAGGAGGGGG + Intronic
1162433138 19:10641434-10641456 AGGTGGTTTCCTGGAGGAGGTGG + Intronic
1163000102 19:14361902-14361924 ATGTGGGGATCTGGAGGAGGAGG + Intergenic
1165769697 19:38372117-38372139 ATGTGTTCACCTGGACCATGAGG - Intergenic
1166445706 19:42856042-42856064 ATGGGGACACCTGGAGGCTGAGG - Intronic
1166716012 19:44968340-44968362 ATGTGGTTACCTGGAGTGGGAGG + Intronic
1166738042 19:45097586-45097608 ATGAGGTGATCTGGAGGAGGGGG + Intronic
1167656552 19:50768133-50768155 ATCTGGGAAGCTGGAGGTTGTGG - Intergenic
928266803 2:29818956-29818978 TGGTGGTAAAGTGGAGGATGTGG - Intronic
930093771 2:47551263-47551285 ATGTGGCTGCCTGGAGGAAGAGG - Intronic
930258287 2:49116378-49116400 AGGGGGTAAGGTGGAGGATGTGG + Intronic
934780389 2:96966152-96966174 GTGTGGGAGCCTGGAGGAGGGGG - Intronic
937260916 2:120586457-120586479 AAGAGGAAACCTGAAGGATGAGG - Intergenic
942683175 2:178500863-178500885 AGCTGGTAACCTGGAGAATATGG - Intronic
942966471 2:181899746-181899768 AAGTGGTACCCAGGAGGTTGAGG + Intronic
944380709 2:199107171-199107193 ATGTGGATACATGGAGCATGAGG - Intergenic
944993165 2:205261349-205261371 TGGTGGTATCTTGGAGGATGTGG - Intronic
945735335 2:213591843-213591865 ATGGGGTATGGTGGAGGATGAGG + Intronic
1169819972 20:9699723-9699745 AAGTGGGAACCTGGAGGACTTGG + Intronic
1172887910 20:38244136-38244158 ATGTTGTTACCTTGAGGAAGCGG + Intronic
1175010135 20:55726481-55726503 ATCTGGAAACCAGGAGGTTGAGG + Intergenic
1175722205 20:61294189-61294211 ATGGGCTGACCTGGAGGCTGGGG + Intronic
1177608141 21:23408575-23408597 CTGTGGAAACTTGGAGGATGGGG + Intergenic
1179127949 21:38608791-38608813 CTGTGGGAATCTGGAGGGTGAGG - Intronic
1179539598 21:42075547-42075569 ATGTGGCAACCTTGAGGCTCAGG + Intronic
1180487785 22:15817895-15817917 TTGTGATAACCTGGAGGAGGGGG - Intergenic
1181338410 22:22159139-22159161 ATGTGGGATCCTGGATAATGTGG + Intergenic
1182791323 22:32955440-32955462 ATGCGGACACCTGGGGGATGAGG + Intronic
1183365963 22:37406946-37406968 CTGTGGCTGCCTGGAGGATGGGG - Intronic
1183532698 22:38370910-38370932 ATTTGAAAACCTGGAGGAGGTGG - Intronic
1184864902 22:47196962-47196984 CTCTGGGAACCTGGAGAATGAGG + Intergenic
950560425 3:13718273-13718295 ATGTGCTCACCTGGAAAATGGGG + Intergenic
951231026 3:20179930-20179952 ATTTGGTAACATGGAGGTTTTGG + Intronic
951943430 3:28108208-28108230 CTCTGGTAAGCTGGAGGATGTGG - Intergenic
954536150 3:51360832-51360854 CTGTGGGAACATGGAGGAGGGGG + Intronic
955882599 3:63563791-63563813 CTTTGGTAACCTAGAGGAGGAGG + Intronic
957270927 3:78029719-78029741 GTGTGGTAACCTAGTGGATCTGG + Intergenic
958075047 3:88665865-88665887 ATTTGGTTACCTCAAGGATGTGG - Intergenic
958168949 3:89914817-89914839 AAGTGGTTCCCAGGAGGATGAGG + Intergenic
959335681 3:105062107-105062129 AAGAGGTAACCTGGAGGTTTAGG - Intergenic
960038300 3:113123831-113123853 ATGTGTGAAACTGGAGGATATGG + Intergenic
961090381 3:124106163-124106185 AAGTGGTAGACTGGAGGAGGGGG + Intronic
962773672 3:138638260-138638282 ATTTGGCATCATGGAGGATGTGG + Intergenic
964298390 3:155259582-155259604 ATGTGGGAACCCAGAGAATGAGG - Intergenic
972770638 4:42194033-42194055 ATGGGGTAATCTGGAGCCTGGGG - Intergenic
974674095 4:65068975-65068997 ATGTGGACAACTGGAGGGTGAGG - Intergenic
975741791 4:77436260-77436282 ATGGGGAAAACTGGGGGATGGGG - Intergenic
977792411 4:101123347-101123369 ATGAAGTCTCCTGGAGGATGTGG + Intronic
981889158 4:149715678-149715700 ATGTGGACAACTGGAGGGTGAGG + Intergenic
983919119 4:173326563-173326585 ATGTGGTAACACCTAGGATGAGG + Intergenic
998813158 5:145986513-145986535 ACGTGGGAGCCTGAAGGATGAGG - Intronic
999086924 5:148900865-148900887 ATGAGGTTACCTGGATGAAGAGG + Intergenic
1000277786 5:159754354-159754376 ATGTAATAAACAGGAGGATGAGG + Intergenic
1000676558 5:164129114-164129136 ATGTGGTTATTTGGAGGAAGAGG + Intergenic
1002362515 5:178684141-178684163 CTGTGGTAACAGGAAGGATGAGG + Intergenic
1003130718 6:3393132-3393154 CTGTGGCAGCCTGGAGGCTGTGG + Intronic
1007784800 6:44273452-44273474 ATCTGGTGACCTGGCGGGTGCGG - Exonic
1009691275 6:67036298-67036320 GTGTGGACACCTGGAGGAAGTGG - Intergenic
1011007021 6:82656954-82656976 AAATGTTCACCTGGAGGATGTGG - Intergenic
1015392772 6:132701794-132701816 ATGTGGTAACCTGGAGGATGGGG - Intronic
1015433897 6:133163466-133163488 ATGAAATAAGCTGGAGGATGGGG + Intergenic
1015817154 6:137222154-137222176 ATGTTGTGACCTGAAGGATAAGG + Intergenic
1016391249 6:143578284-143578306 AAGGGGAAACATGGAGGATGAGG - Intronic
1019162127 6:170075844-170075866 ATGAGGGCACCTGGAGGCTGGGG - Intergenic
1019835706 7:3381234-3381256 AGGTGGTCACCTGGAGGGTGTGG + Intronic
1020174651 7:5872487-5872509 GTGTGGTGACGTGGGGGATGGGG - Intergenic
1020801232 7:12734548-12734570 ATTTTGTGACCTGGAAGATGAGG + Intergenic
1023185346 7:37527284-37527306 AGGTGGGGCCCTGGAGGATGGGG + Intergenic
1024585359 7:50837167-50837189 ATGTGGGAAGTTAGAGGATGAGG - Intergenic
1024866960 7:53914014-53914036 TTGTGGTTACCTGGAAGCTGTGG - Intergenic
1026317886 7:69243131-69243153 ATGTAGAGACCTGGAGAATGTGG + Intergenic
1026941730 7:74290929-74290951 AGGGGGTCCCCTGGAGGATGGGG + Intronic
1028840854 7:95428920-95428942 GTGTTGTAATCTGTAGGATGGGG - Intronic
1029172648 7:98641827-98641849 ATGTGGTCACCTGCAGGACCGGG - Intergenic
1030832603 7:114244349-114244371 ATGTGGTATCCTGGATGATGTGG - Intronic
1032024542 7:128430952-128430974 ATGTGGTCACCTTCAGGAGGCGG + Intergenic
1032586910 7:133155300-133155322 ATGTGGCAAGCTGGGAGATGTGG - Intergenic
1032905382 7:136358946-136358968 AAGTGGTATAGTGGAGGATGGGG - Intergenic
1032981960 7:137294320-137294342 TTGTGTTCACCTGGAGGAAGAGG - Intronic
1033653463 7:143359044-143359066 GTGTGATATTCTGGAGGATGTGG - Intronic
1036042372 8:5100277-5100299 ATTTGATAACCTGGAGGAAATGG + Intergenic
1036407172 8:8465325-8465347 AAGTGATCACCTTGAGGATGAGG - Intergenic
1037835215 8:22211555-22211577 ATGGGGTAAGGTGGAGGAAGAGG - Intronic
1037841468 8:22248277-22248299 ATGTGGGTACCAGGAGGCTGGGG + Exonic
1042106410 8:65332164-65332186 AAGTGGTTTCCTGAAGGATGAGG - Intergenic
1043158983 8:76821884-76821906 ATGAGATAACCTAGAGAATGAGG - Intronic
1043531045 8:81150239-81150261 AGGTGGTAAGCTGGAGGAGGAGG + Intergenic
1043982751 8:86659848-86659870 ATCTGCTAACCTGAAGGATCTGG - Intronic
1044011024 8:86994455-86994477 ATGTGGAATCCTGGGGGATAGGG + Intronic
1044245284 8:89937171-89937193 ATGTGGTGACCTCCAGGATGTGG - Intronic
1044340587 8:91041888-91041910 ATGGGGGATGCTGGAGGATGAGG - Intergenic
1046032377 8:108798595-108798617 ATCTAGTTAGCTGGAGGATGAGG - Intergenic
1048392901 8:133985045-133985067 AGATGGACACCTGGAGGATGTGG + Intergenic
1048623527 8:136160275-136160297 ATGTGGGAACCAGGGAGATGGGG + Intergenic
1051100362 9:13514036-13514058 ATTTGGTGACCTTGAGGAAGAGG + Intergenic
1052244018 9:26311904-26311926 ATGTGGAATCCTGGTGGATTAGG + Intergenic
1052507540 9:29375271-29375293 GTGTTGGAACCTGGAAGATGAGG - Intergenic
1052847770 9:33352293-33352315 GTGTGGCCACCTTGAGGATGTGG + Intronic
1056135233 9:83623832-83623854 GTGTGCTAACCTGGAGACTGAGG + Intronic
1056592659 9:87975933-87975955 GTGTGGTTACCTGGTGGAAGAGG + Intergenic
1057535409 9:95898655-95898677 ATCTGGTTTCCTGGAGGCTGAGG - Intronic
1060175368 9:121493698-121493720 ATGGGGTATCCAGGAGGATGTGG - Intergenic
1060447042 9:123699501-123699523 AGGGGGGAACCTGGAAGATGGGG - Intronic
1060759348 9:126234870-126234892 CACTGGTACCCTGGAGGATGGGG + Intergenic
1185625561 X:1478960-1478982 ATGTGGGAACCTGGAAGTGGTGG - Intronic
1186959637 X:14721935-14721957 CTGTGGAAAGCTGGAGGATGGGG - Intronic
1189213246 X:39302333-39302355 AGTTGGTAGCCTGGAGGTTGAGG - Intergenic
1195302655 X:103546131-103546153 ATTGGGTAACCTGGAAGAAGTGG + Intergenic
1197268767 X:124403646-124403668 ATTTGGTAACCTTAAGGTTGTGG - Intronic
1199384976 X:147213452-147213474 ATGTGGTGTCCCTGAGGATGGGG - Intergenic
1199386167 X:147225814-147225836 ATGTGGTGTCCCTGAGGATGGGG - Intergenic
1200124311 X:153806061-153806083 AAGTGCTCACCTGGATGATGCGG + Exonic
1200397238 X:155998420-155998442 TTGTGATGAGCTGGAGGATGTGG + Intronic
1202366693 Y:24170691-24170713 ATCTGCTACCCTGGAGGATCTGG + Intergenic
1202373712 Y:24214791-24214813 ATCTGCTACCCTGGAGGATCTGG - Intergenic
1202497069 Y:25455329-25455351 ATCTGCTACCCTGGAGGATCTGG + Intergenic
1202504089 Y:25499432-25499454 ATCTGCTACCCTGGAGGATCTGG - Intergenic