ID: 1015392773

View in Genome Browser
Species Human (GRCh38)
Location 6:132701795-132701817
Sequence CATGTGGTAACCTGGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392773_1015392781 5 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392773_1015392788 30 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392773_1015392782 6 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392773_1015392787 29 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392773_1015392783 7 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392773_1015392780 4 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392773_1015392784 11 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392773 Original CRISPR CATGTGGTAACCTGGAGGAT GGG (reversed) Intronic
900280504 1:1864509-1864531 CAGGTGGTAATCGGCAGGATGGG - Intronic
901667195 1:10832920-10832942 CATGAGGTCACCTGGCAGATGGG + Intergenic
907770458 1:57457231-57457253 CATGTGGTAGACCGGAGAATTGG + Intronic
910256343 1:85250956-85250978 TATTTGCAAACCTGGAGGATGGG + Intronic
910543128 1:88383772-88383794 CATATGGGAACAAGGAGGATAGG - Intergenic
911596300 1:99802119-99802141 CATGTAGGAACCTGAAGGAGAGG - Intergenic
916070446 1:161166828-161166850 CATGCGGAAACCTGGGGGAAAGG - Exonic
916687955 1:167164560-167164582 CATATGGGGACCTGGAGGTTGGG - Intergenic
917481480 1:175415539-175415561 CATGTGGGAATCTGCAGGAAGGG + Intronic
918029622 1:180792474-180792496 CATGTGGAACCCTAGAGGGTTGG - Intronic
920395142 1:205639704-205639726 CATGTGGCAATGTGGAGGATGGG - Intergenic
922190733 1:223316446-223316468 CACATGGGAACCTGGAGGAAGGG + Intronic
923140704 1:231160132-231160154 CTTGTGGTCACCAGGAGGCTGGG + Intergenic
1062978618 10:1703339-1703361 CCTGTGGGGACCTGGAGGAGTGG + Intronic
1063744584 10:8865625-8865647 CATGTGGTAACAAGGAGGTAGGG + Intergenic
1063929213 10:11012500-11012522 GATGTGGTAAGCTTGAGGGTGGG - Intronic
1065966076 10:30771601-30771623 CCTGTGGTAAACTGGAAAATAGG - Intergenic
1067033605 10:42897633-42897655 CATGTTGTCACCTGGAGGTGGGG + Intergenic
1067044735 10:42979089-42979111 CATCAGGTAACCTGGAAGAGAGG + Intergenic
1067542573 10:47166438-47166460 AATGTGGTAACCAGGAGGAAGGG + Intergenic
1069708628 10:70475148-70475170 AATGTGGTAACTTGTAGCATAGG + Intergenic
1071135418 10:82447785-82447807 CATGTGGTATTCTAGTGGATGGG + Intronic
1078769775 11:14338396-14338418 CATGAGTTATCCTGGGGGATGGG + Intronic
1078863907 11:15278897-15278919 CAAGTGTTTAGCTGGAGGATGGG + Intergenic
1079363159 11:19786692-19786714 CAAGTGGGAACCTGGGGGAGAGG + Intronic
1079419303 11:20271121-20271143 CAGGTGGGAAACTGGAGGCTTGG + Intergenic
1081235961 11:40647500-40647522 CAGTTTGTAAGCTGGAGGATTGG - Intronic
1081862372 11:46340595-46340617 CAGGAGGAAACCTGGAGGAGGGG - Intronic
1082225630 11:49703280-49703302 CTTGTGGTGAACTGGGGGATGGG + Intergenic
1084322339 11:68380622-68380644 CATGAGGCTTCCTGGAGGATAGG + Intronic
1086546091 11:87969275-87969297 TGTGTGGTTATCTGGAGGATTGG - Intergenic
1090317214 11:125803614-125803636 CAGGTGGTAGCCTGGAGTCTGGG + Intergenic
1091617105 12:2057843-2057865 CATGGGGTGACCTGAAGCATGGG + Intronic
1091993437 12:4974443-4974465 CATGTGGCAATCAGGAGGACAGG - Intergenic
1093628943 12:21385739-21385761 AATATGTTAACCTGGAGGATGGG + Intronic
1094027127 12:25970559-25970581 CATCCGGCAACATGGAGGATGGG - Intronic
1096423940 12:51484945-51484967 CAAGAGGTTACCTGGAGGAAAGG + Intronic
1097373888 12:58817910-58817932 CATGTGATAGACTGGAGGAATGG - Intergenic
1099861806 12:88231545-88231567 TAAGTGATAACCTGGAGGGTAGG - Intergenic
1100152712 12:91760169-91760191 CATGTTGAAAACTGGAGGAAAGG + Intergenic
1101440916 12:104703811-104703833 AATGGGGAAACCTGGAGGAAGGG - Intronic
1101525614 12:105526394-105526416 AATGTGGTACCCTGGAAGAAGGG - Intergenic
1104265764 12:127231337-127231359 CATCTGGTAACCTGGATTTTGGG + Intergenic
1105704567 13:22961108-22961130 CATGTGGTGCCCTGCAGGCTTGG + Intergenic
1106149026 13:27080037-27080059 CATGTGTTAAAATGGGGGATGGG + Intronic
1107301164 13:38967140-38967162 CATGTGGCAACATGGGGGCTGGG - Intronic
1107477296 13:40750953-40750975 AAAGAGGTAAGCTGGAGGATAGG - Intronic
1108954995 13:56142255-56142277 CATGGGGAACCCTGGAGCATTGG - Intergenic
1110861556 13:80349661-80349683 CATGGGGTCACTTGGAAGATTGG + Intergenic
1111803050 13:93003841-93003863 TATGTGGTTTCCTGGAAGATTGG + Intergenic
1114037517 14:18644004-18644026 TATATGGTCACCTGGAGGCTGGG - Intergenic
1114069315 14:19095333-19095355 GTTGTGATAACCTGGAGGAGGGG - Intergenic
1114092946 14:19304669-19304691 GTTGTGATAACCTGGAGGAGGGG + Intergenic
1114121115 14:19671043-19671065 TATATGGTCACCTGGAGGCTGGG + Intergenic
1114581528 14:23764800-23764822 CATGGGGTCACTGGGAGGATTGG - Intergenic
1116710646 14:48364002-48364024 GATGTGGTCACCTAGAGGAGAGG + Intergenic
1116960420 14:50962950-50962972 CATGGGGTAAGCTGCAGTATCGG + Intergenic
1117095856 14:52296589-52296611 CATCTGGTAACCTGGATTTTTGG - Intergenic
1119116251 14:72024462-72024484 CATGTGTTCTCCTGGAGGACAGG - Intronic
1123435641 15:20252078-20252100 CATGTCGTAACTTGGAGTATGGG + Intergenic
1125656225 15:41359920-41359942 AATGTGGTAACAGTGAGGATGGG - Intronic
1126439596 15:48673182-48673204 CATGTAGTGACCTGGGGGAGGGG - Intergenic
1126567058 15:50112088-50112110 CATGTGGTAAACTGAGGGGTTGG + Intronic
1127362781 15:58259769-58259791 GAAGTGCTAACCTGGAGGAGAGG - Intronic
1129294071 15:74590051-74590073 GATGTTGTAACCTAGAGGAGAGG + Intronic
1129545022 15:76386656-76386678 CATGTGGACACCTGGGGGAAGGG + Intronic
1131643511 15:94317399-94317421 CAGGTGATAACCAGGAGGAATGG - Intronic
1132132132 15:99292202-99292224 CAAGGGAAAACCTGGAGGATAGG - Intronic
1139319914 16:66106115-66106137 CCTGTGCTACCCTGGAGAATCGG + Intergenic
1141991159 16:87611088-87611110 TTTGTGGTAACGTGGAAGATTGG + Intronic
1144589757 17:16514188-16514210 CATGTGGTATACTGAAGGAAGGG - Intergenic
1145037832 17:19553505-19553527 CAGGTGGTGGCATGGAGGATTGG - Intronic
1146483490 17:33224587-33224609 CATGTGGAAACAGGGAGGAGGGG + Intronic
1148742663 17:49901740-49901762 TATGTGGAGACCTGGAGCATGGG + Intergenic
1149300647 17:55302132-55302154 CATGAGGTGACCTGCAGGAGAGG + Intronic
1149590532 17:57826467-57826489 CATGTCTTAACCTGGGTGATGGG + Intergenic
1149899098 17:60457309-60457331 CTAGTGGTTACCTGGAGGGTGGG - Intronic
1154382343 18:13863894-13863916 CAAGTGGCAACCTGGGGCATGGG + Intergenic
1155688134 18:28580786-28580808 CAGGTAGCAACCTGGAGGGTGGG + Intergenic
1156268090 18:35506379-35506401 AAAGTGGTAACCTTGGGGATTGG - Intergenic
1156270632 18:35527159-35527181 CATGGGGTTTCCTGGAGGGTTGG - Intergenic
1158029084 18:52940505-52940527 AATGTGCTCCCCTGGAGGATGGG + Intronic
1158293973 18:55973250-55973272 CTGTTGGTAATCTGGAGGATAGG - Intergenic
1160937277 19:1602816-1602838 CATGGGGTGACCAGGATGATAGG - Intronic
1164399704 19:27894158-27894180 CAGGTGGAAAACTGGAGGAATGG - Intergenic
1165031800 19:33002948-33002970 CATGTCGTAACTTGGAGTATGGG + Exonic
1165606512 19:37109718-37109740 AAGGTGGTAACGTGGAGGAGAGG - Intronic
1166573149 19:43812014-43812036 CTTGTGGTCAGCTGGAGGGTTGG + Intronic
925532300 2:4877539-4877561 CAGGTGGTGACCAGGAGGATGGG + Intergenic
926156151 2:10455030-10455052 CTGGTGGGAGCCTGGAGGATGGG - Intergenic
926824174 2:16885780-16885802 AATGGGATAACCTGGAGGATGGG - Intergenic
932435284 2:71699674-71699696 CAGGAGCTACCCTGGAGGATCGG - Intergenic
934780390 2:96966153-96966175 CGTGTGGGAGCCTGGAGGAGGGG - Intronic
936708085 2:115099721-115099743 CATGCTGTCTCCTGGAGGATGGG + Intronic
938273460 2:129995034-129995056 TATATGGTCACCTGGAGGCTGGG + Intergenic
938442752 2:131351075-131351097 TATATGGTCACCTGGAGGCTGGG - Intronic
938490228 2:131757266-131757288 CATGTGTTCACCTGGAGCCTGGG + Intronic
944529290 2:200651518-200651540 CATGTGGAAAGCAGGAGGGTGGG + Intronic
945983737 2:216338348-216338370 CAAGTGGGAGTCTGGAGGATGGG + Intronic
946175822 2:217921455-217921477 CATGCGGTCAGCTGGAGGAAGGG - Intronic
1168758588 20:333117-333139 CATGTGGCTATCTGGAGGAAGGG - Intergenic
1170901574 20:20468517-20468539 CAAGTCTTCACCTGGAGGATTGG - Intronic
1173967553 20:47124590-47124612 CATGTGGTGACATGGGAGATGGG - Intronic
1175131222 20:56791042-56791064 CATGTGGTACCTTGGAGGACGGG + Intergenic
1175722204 20:61294188-61294210 CATGGGCTGACCTGGAGGCTGGG + Intronic
1176707402 21:10126274-10126296 CATGTGTTCACCTGGAGCCTGGG + Intergenic
1177608140 21:23408574-23408596 GCTGTGGAAACTTGGAGGATGGG + Intergenic
1180461645 22:15571046-15571068 TATATGGTCACCTGGAGGCTGGG - Intergenic
1180487786 22:15817896-15817918 GTTGTGATAACCTGGAGGAGGGG - Intergenic
1183365964 22:37406947-37406969 CCTGTGGCTGCCTGGAGGATGGG - Intronic
952216170 3:31279751-31279773 AATGTGGTAACCTGATGTATAGG - Intergenic
952786429 3:37160106-37160128 CTTCTGGTATCCTGGAGAATAGG - Intronic
953976565 3:47385997-47386019 CATGTGATAAACAGGAGGAAGGG - Intronic
954421716 3:50422336-50422358 CCTGTGGCAACCTGGGGGAGTGG - Intronic
956610902 3:71121853-71121875 ACTTTGGGAACCTGGAGGATGGG - Intronic
958545279 3:95540194-95540216 GCTGTGGTAACCTGGTGGAAAGG + Intergenic
961374753 3:126456875-126456897 GATGTGGTAACCTGGATCACTGG - Intronic
961530597 3:127537644-127537666 CCCGTGGCAACCTGGAGGAAGGG - Intergenic
965507333 3:169530978-169531000 GGTGTGGTAACCTGCAGGAGAGG - Intronic
971321874 4:25612247-25612269 CATGTGGAATCCTGGAGCCTGGG + Intergenic
973582436 4:52357658-52357680 CATGTGGTAACCTGTAGAGAGGG + Intergenic
974914039 4:68157356-68157378 CATGTGGGGACCTGAAGAATTGG + Intergenic
976167166 4:82268342-82268364 CAAGTGGGGACCTGAAGGATGGG - Intergenic
976913511 4:90339639-90339661 CATGCAGTAATCTGGAGGAAGGG - Intronic
978656102 4:111067454-111067476 CATGTGGAACCCTAGAAGATGGG + Intergenic
978848070 4:113298430-113298452 CAATTGGTGACCAGGAGGATTGG + Intronic
980806846 4:137827209-137827231 CATCTTGTAATCTGGATGATTGG - Intergenic
982255042 4:153443445-153443467 CAGCTGGTAGCCTGGAGGACAGG + Intergenic
985854864 5:2416861-2416883 CATGTGAGAGCTTGGAGGATGGG - Intergenic
987045025 5:14099671-14099693 CATGTGATAATCTTGAGGACAGG + Intergenic
988786268 5:34568191-34568213 CATGTTTCAACCTGGAGGAAAGG - Intergenic
989607110 5:43255161-43255183 TCTGTGGTAACATGGAAGATGGG + Intronic
990873853 5:60462558-60462580 TATGTGGTCACCGTGAGGATAGG - Intronic
992488604 5:77219440-77219462 CATATGGTACCCTGGGTGATAGG - Intronic
992732581 5:79688472-79688494 TATGTGGGAACCTGGAAGAGAGG + Intergenic
994261532 5:97665207-97665229 CATGTGGTAAGCTTGAGGTTGGG - Intergenic
995540540 5:113182000-113182022 GATGTGCTAACATGGAGGAGAGG + Intronic
997203990 5:132030738-132030760 AATGTGGTAAGCTGGAGGTCGGG + Intergenic
1003017206 6:2477841-2477863 CCTGTGCTGACATGGAGGATCGG - Intergenic
1010617087 6:78026529-78026551 CATTTAGTAACCTGGAGTAGGGG + Intergenic
1015392773 6:132701795-132701817 CATGTGGTAACCTGGAGGATGGG - Intronic
1015433896 6:133163465-133163487 CATGAAATAAGCTGGAGGATGGG + Intergenic
1017233350 6:152095476-152095498 CATGTGGGTACAAGGAGGATAGG - Intronic
1017291570 6:152744275-152744297 AATGTGGGAACTTGGAGGAAGGG - Intergenic
1017890426 6:158633240-158633262 CATGTGGACACATGGAGGACAGG - Exonic
1019901826 7:4026925-4026947 TATGTGGTAACCTGGAGAAATGG + Intronic
1020998112 7:15290600-15290622 CATGTGGTCACATAGAGGAATGG + Intronic
1021424167 7:20480810-20480832 CATGTTGGAAACTGGAGGAAAGG + Intergenic
1021878446 7:25070435-25070457 CTTCTGGTAATCTGGAGGGTTGG + Intergenic
1024318455 7:48042990-48043012 CATCTGGAAACCTGGAGGTGTGG + Intronic
1029172649 7:98641828-98641850 GATGTGGTCACCTGCAGGACCGG - Intergenic
1032506231 7:132436626-132436648 CATGTAGCAACTTGGAGGAGGGG - Intronic
1032838800 7:135697867-135697889 CATGTGGAAACCTGAAGGACGGG - Intronic
1036989706 8:13578776-13578798 CATGGGGGTACCTGGAGGGTGGG - Intergenic
1040015616 8:42696721-42696743 CATGTGGGAACCAGCAGAATAGG + Intergenic
1044011023 8:86994454-86994476 GATGTGGAATCCTGGGGGATAGG + Intronic
1053644589 9:40112994-40113016 CATGTGTTCACCTGGAGCCTGGG + Intergenic
1053761393 9:41351857-41351879 CATGTGTTCACCTGGAGCCTGGG - Intergenic
1054350166 9:64013402-64013424 CATGTGTTCACCTGGAGCCTGGG - Intergenic
1054539987 9:66262975-66262997 CATGTGTTCACCTGGAGCCTGGG - Intergenic
1060709334 9:125841826-125841848 CATGTAGTAAACTGCAGTATTGG + Intronic
1060750828 9:126167454-126167476 TATGTTGTAACCTGCAGAATTGG + Intergenic
1061373842 9:130212699-130212721 CCTGTGGGAACCTGCAGGAGTGG + Intronic
1062404930 9:136391712-136391734 CATGGGGAGACCTGGAGGACTGG + Intronic
1202792149 9_KI270719v1_random:95154-95176 CATGTGTTCACCTGGAGCCTGGG + Intergenic
1186959638 X:14721936-14721958 GCTGTGGAAAGCTGGAGGATGGG - Intronic
1194533675 X:95079749-95079771 CATGTGGTGACATGGAGAAGAGG + Intergenic
1201753904 Y:17466482-17466504 AATGGGGTAACCTTAAGGATAGG + Intergenic
1201847648 Y:18439503-18439525 AATGGGGTAACCTTAAGGATAGG - Intergenic
1202335843 Y:23810463-23810485 AATGGGGTAACCTTAAGGATAGG + Intergenic
1202534924 Y:25859604-25859626 AATGGGGTAACCTTAAGGATAGG - Intergenic