ID: 1015392774

View in Genome Browser
Species Human (GRCh38)
Location 6:132701796-132701818
Sequence CCATGTGGTAACCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392774_1015392787 28 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392774_1015392781 4 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392774_1015392780 3 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392774_1015392783 6 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392774_1015392784 10 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392774_1015392788 29 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392774_1015392782 5 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392774 Original CRISPR CCATGTGGTAACCTGGAGGA TGG (reversed) Intronic
900280505 1:1864510-1864532 CCAGGTGGTAATCGGCAGGATGG - Intronic
900336490 1:2166616-2166638 CCATGTCGTGGCCTGGGGGAGGG - Intronic
900777690 1:4596806-4596828 CCATGTGGGAACCTGCTGGGAGG - Intergenic
901089979 1:6634679-6634701 CCAAGTGGGCACGTGGAGGAAGG + Exonic
902237971 1:15069781-15069803 TCACGTGGTAGCCTGGAGAATGG - Intronic
903269662 1:22179414-22179436 CCATGAGGTGACCTTGAAGATGG + Intergenic
903541147 1:24097095-24097117 CCATGGGGTGACCTCCAGGAGGG + Intronic
903925782 1:26829459-26829481 CCATGAGGCCACCTGCAGGAAGG - Intronic
905513435 1:38542716-38542738 CCTGGTAGCAACCTGGAGGAGGG + Intergenic
908173928 1:61535259-61535281 CCATGTAGTCACCAGGAGTAAGG + Intergenic
908560361 1:65300283-65300305 CCATGAGTTAACCTTGAGGGTGG - Intronic
908578153 1:65483740-65483762 CCATGTGGATATCTGGAGGATGG - Intronic
908669673 1:66532983-66533005 CCAAGTGGAAACCTGGAGGGAGG - Intergenic
909547434 1:76863313-76863335 CCATGAGGCTATCTGGAGGAAGG - Intergenic
909925337 1:81431485-81431507 CAAAGTGGTAGCGTGGAGGAGGG + Intronic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
911477384 1:98390261-98390283 CCATGTGGCAAACTAGAGGGAGG + Intergenic
912147743 1:106814839-106814861 CCATGTGGATATCTGCAGGAAGG - Intergenic
912626491 1:111209048-111209070 CCATGAGTCAACCTGGGGGAAGG - Intronic
913687619 1:121248177-121248199 CAATGAAGAAACCTGGAGGAGGG - Intronic
914039481 1:144035822-144035844 CAATGAAGAAACCTGGAGGAGGG - Intergenic
914149978 1:145032114-145032136 CAATGAAGAAACCTGGAGGAGGG + Intronic
917481479 1:175415538-175415560 CCATGTGGGAATCTGCAGGAAGG + Intronic
917871868 1:179249312-179249334 CAACGTGGGAATCTGGAGGAAGG + Intergenic
918340342 1:183563371-183563393 CCTTGTGCTGGCCTGGAGGAGGG - Intronic
919077613 1:192831894-192831916 CCTTGTGGTAACAAGGAGGCTGG - Intergenic
920395143 1:205639705-205639727 CCATGTGGCAATGTGGAGGATGG - Intergenic
920474946 1:206266698-206266720 CAATGAAGAAACCTGGAGGAGGG - Intronic
921163889 1:212492109-212492131 CCATATGGCAACCTTGAAGATGG + Intergenic
922190732 1:223316445-223316467 CCACATGGGAACCTGGAGGAAGG + Intronic
922451223 1:225738997-225739019 CCATGAGGTAGCCTTGTGGATGG + Intergenic
922756559 1:228100222-228100244 CAATGTGGGAACCTGGGGCAGGG - Intergenic
923140703 1:231160131-231160153 CCTTGTGGTCACCAGGAGGCTGG + Intergenic
1062855071 10:775923-775945 CCTTCTGGTCACCTGGTGGACGG + Intergenic
1063283680 10:4660294-4660316 CCATGTGGTAGGTGGGAGGAGGG - Intergenic
1063744583 10:8865624-8865646 ACATGTGGTAACAAGGAGGTAGG + Intergenic
1065618026 10:27549076-27549098 CCATGAGGTAGTCTTGAGGATGG - Intergenic
1065865845 10:29914630-29914652 CCATGTCATAGCCTTGAGGATGG - Intergenic
1066008030 10:31165944-31165966 CCCTGTGCCAGCCTGGAGGATGG + Intergenic
1067033604 10:42897632-42897654 ACATGTTGTCACCTGGAGGTGGG + Intergenic
1067226426 10:44379207-44379229 GCATGAGGAAGCCTGGAGGAAGG + Intronic
1067542572 10:47166437-47166459 GAATGTGGTAACCAGGAGGAAGG + Intergenic
1070844161 10:79508163-79508185 CCATTTTGAAACCTGGAGGAGGG - Intergenic
1070929636 10:80252148-80252170 CCATTTTGAAACCTGGAGGAGGG + Intergenic
1071743470 10:88388573-88388595 CCATGTGATAACATGGAGACAGG - Intronic
1072623102 10:97093552-97093574 CCATGAGGTGACCTTGAGGATGG + Intronic
1072722429 10:97789212-97789234 CCCTGAGGGAGCCTGGAGGAAGG - Intergenic
1073545793 10:104347818-104347840 CCCTGTGGGAACCTGGTGGCAGG - Intergenic
1076248424 10:128965688-128965710 CCATGGGATTACCTGGAAGATGG - Intergenic
1078908202 11:15706966-15706988 CCTGGTGGTAACCTGGAGATGGG + Intergenic
1079312716 11:19380626-19380648 CCATGGTGTGACGTGGAGGAAGG + Intronic
1081862373 11:46340596-46340618 GCAGGAGGAAACCTGGAGGAGGG - Intronic
1082225629 11:49703279-49703301 CCTTGTGGTGAACTGGGGGATGG + Intergenic
1089103022 11:115980243-115980265 CCATTTGGTCACCTGGAGTCGGG - Intergenic
1089187952 11:116633743-116633765 CCATGAGGTGACCATGAGGATGG - Intergenic
1089736858 11:120555646-120555668 CCAGGTGGTGAGGTGGAGGAGGG + Intronic
1089783308 11:120890031-120890053 CCATGTAGTAAGTTGGAGGGTGG + Intronic
1089852332 11:121510451-121510473 CCATGAGGTAATCTTGAGAATGG - Intronic
1092118064 12:6023643-6023665 CAAGGTGGTGACCTGGAGGACGG - Exonic
1093628942 12:21385738-21385760 TAATATGTTAACCTGGAGGATGG + Intronic
1093887284 12:24476649-24476671 CAGTGTGGTAACTTGGAAGAGGG - Intergenic
1096620401 12:52861106-52861128 AAAGGTGGTTACCTGGAGGAGGG - Intergenic
1099658234 12:85522434-85522456 CCATGTGATACCCAGCAGGAAGG + Intergenic
1101122011 12:101591955-101591977 CCATGAGGTTACCAGGAGGATGG + Intronic
1101416629 12:104514162-104514184 CTATGTGGCCACCTGGAGTAGGG - Intronic
1101440917 12:104703812-104703834 TAATGGGGAAACCTGGAGGAAGG - Intronic
1101525615 12:105526395-105526417 CAATGTGGTACCCTGGAAGAAGG - Intergenic
1102248604 12:111370467-111370489 CCATGTGGTTATCTGGGAGAAGG + Intergenic
1102709738 12:114915550-114915572 CCCTGTGGGAATCTGTAGGAAGG + Intergenic
1102801941 12:115742994-115743016 CCAAGTGGTTATCTTGAGGAGGG - Intergenic
1103232615 12:119344489-119344511 CCAGGTAGTAACCTTGGGGAAGG - Intronic
1104056283 12:125233356-125233378 CCATGAGGTGACCATGAGGATGG - Intronic
1104506324 12:129335986-129336008 CCATGAGGTAATCATGAGGATGG + Intronic
1105782504 13:23716516-23716538 ACATGTGGTACACTGGAGGCTGG + Intergenic
1106068916 13:26387734-26387756 CCATGTGGAGACCTAGAAGATGG - Intronic
1106602973 13:31202813-31202835 CCATGAGGTGACCTTGAAGATGG + Intronic
1108572951 13:51768558-51768580 CCCTGGGGTATCCGGGAGGATGG - Intronic
1114069316 14:19095334-19095356 GGTTGTGATAACCTGGAGGAGGG - Intergenic
1114092945 14:19304668-19304690 GGTTGTGATAACCTGGAGGAGGG + Intergenic
1115522640 14:34248273-34248295 CCATGAGGTAAACTTGAGAATGG - Intronic
1116175535 14:41465484-41465506 CCATAAGGAAACTTGGAGGAAGG + Intergenic
1117424320 14:55579892-55579914 CCAGGTGGTGCCCTGGAGGGAGG + Intronic
1119650972 14:76382477-76382499 CCATCTGTTATCCTGGAGAAGGG - Intronic
1119667929 14:76498302-76498324 CCATGAGGAGCCCTGGAGGACGG + Exonic
1121848975 14:97202015-97202037 CCATGAGGCAACCTTGAAGATGG - Intergenic
1122324025 14:100871980-100872002 CCATGGGACACCCTGGAGGAAGG - Intergenic
1123435640 15:20252077-20252099 TCATGTCGTAACTTGGAGTATGG + Intergenic
1123942083 15:25221552-25221574 CCATGGGGTCACCTCCAGGATGG + Intergenic
1125102635 15:35932706-35932728 CCATCTGTGAACCAGGAGGAGGG - Intergenic
1125192630 15:37011102-37011124 ACATGTGTTCATCTGGAGGACGG - Intronic
1125897144 15:43312123-43312145 CCATGACCTAACCTTGAGGATGG - Intergenic
1125934308 15:43621612-43621634 CCATTTGGTCACCTGTAGGTTGG - Intergenic
1126439597 15:48673183-48673205 CCATGTAGTGACCTGGGGGAGGG - Intergenic
1127706915 15:61556533-61556555 CTATGTGGTACCCTGGAAGAAGG + Intergenic
1129545021 15:76386655-76386677 CCATGTGGACACCTGGGGGAAGG + Intronic
1130073864 15:80671901-80671923 ACATCTGGTAAGCAGGAGGAAGG - Intergenic
1133414295 16:5594184-5594206 CCTTCTGTTAACCTGTAGGATGG + Intergenic
1134165756 16:11927991-11928013 CTATTTTGAAACCTGGAGGATGG - Intronic
1134234410 16:12454220-12454242 CCATGTGGTAACCTGGGGGATGG + Intronic
1134500351 16:14764869-14764891 CTATTTTGAAACCTGGAGGATGG + Intronic
1134526892 16:14951481-14951503 CTATTTTGAAACCTGGAGGATGG + Intronic
1134545512 16:15104870-15104892 CTATTTTGAAACCTGGAGGATGG - Intronic
1134580228 16:15364181-15364203 CTATTTTGAAACCTGGAGGATGG - Intronic
1134714469 16:16349958-16349980 CTATTTTGAAACCTGGAGGATGG + Intergenic
1134722344 16:16393322-16393344 CTATTTTGAAACCTGGAGGATGG + Intronic
1134945083 16:18318547-18318569 CTATTTTGAAACCTGGAGGATGG - Intronic
1134952347 16:18358700-18358722 CTATTTTGAAACCTGGAGGATGG - Intergenic
1135311148 16:21405405-21405427 CTATTTTGAAACCTGGAGGATGG - Intronic
1135364100 16:21837856-21837878 CTATTTTGAAACCTGGAGGATGG - Intronic
1135447742 16:22533492-22533514 CTATTTTGAAACCTGGAGGATGG + Intronic
1135825097 16:25720170-25720192 TCATGTGGAAATCTGGAAGAAGG + Intronic
1136150301 16:28343300-28343322 CTATTTTGAAACCTGGAGGATGG - Intronic
1136166538 16:28457138-28457160 CTATTTTGAAACCTGGAGGATGG - Intronic
1136196436 16:28657894-28657916 CTATTTTGAAACCTGGAGGATGG + Intronic
1136212776 16:28772019-28772041 CTATTTTGAAACCTGGAGGATGG + Intronic
1136257499 16:29051938-29051960 CTATTTTGAAACCTGGAGGATGG + Intronic
1136307852 16:29384401-29384423 CTATTTTGAAACCTGGAGGATGG - Intronic
1136321268 16:29485945-29485967 CTATTTTGAAACCTGGAGGATGG - Intronic
1136435948 16:30225915-30225937 CTATTTTGAAACCTGGAGGATGG - Intronic
1137762932 16:50955257-50955279 CAATGTGGTAACCTGGAAACCGG + Intergenic
1139487222 16:67264733-67264755 CCATGTGGTCACCTGCTGGGAGG + Intronic
1139855542 16:69976844-69976866 CTATTTTGAAACCTGGAGGATGG - Intergenic
1139908446 16:70381891-70381913 CCAGGCGGGGACCTGGAGGATGG + Intronic
1140367191 16:74391257-74391279 CTATTTTGAAACCTGGAGGATGG + Intronic
1141806531 16:86345559-86345581 CCATGTGGTGAGCTGGGAGAGGG - Intergenic
1141807563 16:86351952-86351974 CCATGTGGTGAGCTGGGAGAGGG + Intergenic
1143906968 17:10216607-10216629 CCATTTGCAAAGCTGGAGGAGGG + Intergenic
1144167718 17:12628645-12628667 CCATGAAGTAACCTGGAGAATGG - Intergenic
1144589758 17:16514189-16514211 CCATGTGGTATACTGAAGGAAGG - Intergenic
1144605149 17:16658298-16658320 CCATTTGGGAGTCTGGAGGATGG + Intergenic
1146128005 17:30244197-30244219 TCATGGGGTAACCTGAAAGATGG + Intergenic
1146483489 17:33224586-33224608 GCATGTGGAAACAGGGAGGAGGG + Intronic
1147120561 17:38332995-38333017 CCATGTGGCAAGCTAGAGGCAGG - Intronic
1147326523 17:39672350-39672372 CCTAGTGGTGTCCTGGAGGAGGG + Exonic
1147903073 17:43803217-43803239 CCGTGTGGGTGCCTGGAGGAGGG - Intronic
1153054038 18:928068-928090 CGCTGTGGGAACCAGGAGGAGGG + Intergenic
1153348321 18:4052138-4052160 CCATTTGGGAGTCTGGAGGATGG + Intronic
1154117013 18:11620032-11620054 CTATTTTGAAACCTGGAGGATGG - Intergenic
1154123284 18:11668995-11669017 CCATGTGAGAACCTGGCTGATGG + Intergenic
1154485377 18:14867959-14867981 CCCTGTGGTGAGCTGGAGGTTGG + Intergenic
1157255751 18:46137535-46137557 CCATAAGGTGACCTTGAGGAGGG - Intergenic
1157678342 18:49584041-49584063 CCTTGTGTCAGCCTGGAGGAGGG + Intronic
1157949401 18:52017730-52017752 TCCTGTGGTAACTTGGAAGATGG + Intergenic
1158322417 18:56278204-56278226 GCATGTGGGATCCTTGAGGATGG - Intergenic
1158324040 18:56294971-56294993 CCTTGTGGTAATCTGGCGCATGG + Intergenic
1159161119 18:64644890-64644912 TTATCTGGTAACGTGGAGGAAGG - Intergenic
1160993129 19:1869070-1869092 CCATGTGGGACCCTGGATGGGGG + Intergenic
1161533834 19:4806541-4806563 CCATGTAGGTACCTGGGGGAAGG + Intergenic
1162886523 19:13701767-13701789 TCATGAGGCAACCTTGAGGATGG - Intergenic
1164594208 19:29523177-29523199 CCAGGGGCTCACCTGGAGGAGGG + Intergenic
1164973783 19:32554854-32554876 CCATTTGGCATCCTGGTGGAAGG - Intergenic
1165031799 19:33002947-33002969 TCATGTCGTAACTTGGAGTATGG + Exonic
1166971500 19:46571620-46571642 CCCTGTGCTGCCCTGGAGGAAGG - Intronic
1168585915 19:57591747-57591769 CCACGTGGTGACATGGAGGCTGG - Exonic
925336105 2:3100521-3100543 CTCTGTGGTTTCCTGGAGGAGGG - Intergenic
925532299 2:4877538-4877560 CCAGGTGGTGACCAGGAGGATGG + Intergenic
926602753 2:14863842-14863864 CCATCAGGTGACCTGCAGGAAGG - Intergenic
926731897 2:16041868-16041890 CCCTGTGGTTGGCTGGAGGAGGG + Intergenic
926824175 2:16885781-16885803 AAATGGGATAACCTGGAGGATGG - Intergenic
928394095 2:30930982-30931004 CCATGTGGCCGCCTGGAGGGGGG - Intronic
930675375 2:54195543-54195565 CCATGAGGTGCCCTGGAGGATGG - Intronic
932596126 2:73094615-73094637 CCATGTGGGAACCACAAGGATGG + Intronic
934780391 2:96966154-96966176 GCGTGTGGGAGCCTGGAGGAGGG - Intronic
934971957 2:98770945-98770967 CCATGTGATGACCGGGAAGATGG - Intergenic
935022414 2:99244540-99244562 CCTTTGGGTAAACTGGAGGAAGG - Intronic
935679354 2:105622394-105622416 CCATGGGGTGATCTGGGGGAAGG + Intergenic
938094953 2:128455607-128455629 CCTTGTGGGAGCCTGGAGGCTGG - Intergenic
938168720 2:129056499-129056521 CCACCTGGTAACCTGGAACATGG - Intergenic
938490227 2:131757265-131757287 CCATGTGTTCACCTGGAGCCTGG + Intronic
940445327 2:153770825-153770847 CCATTTGGGAACCTGTAGGTGGG - Intergenic
945983736 2:216338347-216338369 CCAAGTGGGAGTCTGGAGGATGG + Intronic
946175823 2:217921456-217921478 GCATGCGGTCAGCTGGAGGAAGG - Intronic
946520944 2:220464104-220464126 CCATCTGTGAACCGGGAGGAAGG - Intergenic
948303985 2:236932952-236932974 CCATCGGGAAACCAGGAGGAAGG + Intergenic
1168758589 20:333118-333140 ACATGTGGCTATCTGGAGGAAGG - Intergenic
1169407664 20:5336643-5336665 CCCTGTGGTTTCATGGAGGATGG - Intergenic
1169476079 20:5932455-5932477 CCATGTGGACACCTGGGGCAAGG + Intergenic
1169587922 20:7107264-7107286 CCATCTGTGAACCAGGAGGAAGG + Intergenic
1170120259 20:12903785-12903807 CCATGAGGTAAACGGGTGGATGG + Intergenic
1171962913 20:31507937-31507959 TCATGAGGTGACCTTGAGGATGG + Intergenic
1172038368 20:32026390-32026412 CCATGAGGTGACCTTGAGGATGG - Intronic
1173317868 20:41961301-41961323 CCATCTGGAAACCAGAAGGAAGG - Intergenic
1173583685 20:44165779-44165801 CCATGTAGGTATCTGGAGGAAGG - Intronic
1173887407 20:46472522-46472544 CCATGTGGATTCCAGGAGGAAGG + Intergenic
1174411626 20:50340357-50340379 CCCTGTGGCTATCTGGAGGAAGG - Intergenic
1174903800 20:54528446-54528468 CCATGAGGTAACCTCTAGGTGGG - Intronic
1175122528 20:56727159-56727181 TCATGTCGTATCCTGGAGTAGGG - Intergenic
1175131221 20:56791041-56791063 ACATGTGGTACCTTGGAGGACGG + Intergenic
1176707401 21:10126273-10126295 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1176724014 21:10414867-10414889 CCCTGTGGTGAGCTGGAGGTTGG + Intergenic
1176795957 21:13371517-13371539 CCCTGTGGTGAGCTGGAGGTTGG - Intergenic
1178898837 21:36583092-36583114 CCATGTGGACCCCTTGAGGAAGG - Intergenic
1179128116 21:38610716-38610738 CCATGTGGTCACAGGAAGGAGGG - Intronic
1179543672 21:42100647-42100669 CAATTTTGTACCCTGGAGGATGG - Intronic
1179931854 21:44575906-44575928 CCATTTGGAAACCTGAAAGAGGG - Intronic
1180021108 21:45127674-45127696 CTGAGTGGGAACCTGGAGGAAGG - Intronic
1180487787 22:15817897-15817919 GGTTGTGATAACCTGGAGGAGGG - Intergenic
1180569495 22:16702059-16702081 CAAGGTGGTGACCTGGAGGACGG - Intergenic
1183105104 22:35609989-35610011 CCATGAGGCAACTTTGAGGATGG + Intronic
1183278594 22:36918871-36918893 CCATGAGGTTACCTTGAGGATGG - Intronic
1183374386 22:37454524-37454546 TCATGAGGTGACCTTGAGGATGG + Intergenic
1184091091 22:42293402-42293424 CCAGGTGGTTTCCTGGAGGTGGG + Intronic
952365761 3:32673600-32673622 CCATGAACTCACCTGGAGGAAGG - Intergenic
953352249 3:42224010-42224032 ACCTGTGCTAACCTGGGGGAAGG + Exonic
953976566 3:47385998-47386020 CCATGTGATAAACAGGAGGAAGG - Intronic
954287196 3:49627315-49627337 CCATGTGTGAACTTGGAGAAGGG - Intronic
954532674 3:51334281-51334303 CCTTTTGGGAGCCTGGAGGAAGG + Intronic
956106497 3:65824250-65824272 CCATGTGGGATCTTGGAGGACGG + Intronic
956784611 3:72632052-72632074 GCATGAGGTAACCTTGAAGATGG + Intergenic
956804712 3:72797982-72798004 CCATGTGACAGCCTGGAAGAGGG - Intronic
956900782 3:73713747-73713769 CCATGTGAATATCTGGAGGAAGG - Intergenic
957443861 3:80290330-80290352 CCATGTGTTAAACGGAAGGATGG + Intergenic
957608859 3:82441157-82441179 CCATGAGGTAAACTGGAGTGGGG + Intergenic
961526103 3:127498661-127498683 CCATGTGGTAAGAAGGAGCAGGG - Intergenic
961530599 3:127537645-127537667 CCCCGTGGCAACCTGGAGGAAGG - Intergenic
961905557 3:130259578-130259600 GCATGTTGCTACCTGGAGGAGGG + Intergenic
962073706 3:132058190-132058212 CCATGTGGTGACAGTGAGGATGG + Intronic
962242951 3:133766786-133766808 CCATGGGGTGACCTTGAAGATGG - Intronic
962326961 3:134442405-134442427 CCAGGTGGTCACCTCCAGGAAGG + Intergenic
963258322 3:143168833-143168855 CCCTGCTCTAACCTGGAGGAGGG + Intergenic
963385435 3:144586375-144586397 CCATTTTGTAACCATGAGGAAGG + Intergenic
964282391 3:155080255-155080277 CCAGAGGGTGACCTGGAGGAGGG + Intronic
969031398 4:4217892-4217914 CTTTGTGGAAAGCTGGAGGAGGG + Intronic
969103791 4:4789887-4789909 CCATGAGGTGACCTTGAGAATGG - Intergenic
969222897 4:5772969-5772991 ACATGTGATGACCAGGAGGATGG - Intronic
972552187 4:40144168-40144190 CCATGTGGGCAGCTGGAGGCTGG - Intronic
972818202 4:42668271-42668293 CTATGAGGTGACCTTGAGGATGG - Intergenic
973582435 4:52357657-52357679 ACATGTGGTAACCTGTAGAGAGG + Intergenic
973784222 4:54320346-54320368 CCATGAAGTAAACTTGAGGATGG - Intergenic
974591534 4:63954299-63954321 CCATTTGGAAACCAGGAGGAGGG - Intergenic
976167167 4:82268343-82268365 CCAAGTGGGGACCTGAAGGATGG - Intergenic
976913512 4:90339640-90339662 ACATGCAGTAATCTGGAGGAAGG - Intronic
979373214 4:119914213-119914235 CCATCTGGGGATCTGGAGGATGG + Intergenic
979519391 4:121649344-121649366 CCATGAAGTACCCTGGAAGATGG - Intergenic
980538416 4:134160344-134160366 GCCTGGGGTTACCTGGAGGAGGG - Intergenic
981713011 4:147727416-147727438 CCATGAGGTGACATTGAGGATGG + Intergenic
982080657 4:151786537-151786559 TCATGTTGGAGCCTGGAGGAGGG + Intergenic
982294921 4:153817968-153817990 CCATGTCCTCACGTGGAGGAAGG - Intergenic
983192621 4:164770887-164770909 CCATGTGGTAACCATGTGGTGGG - Intergenic
986004697 5:3657943-3657965 CTATCTGGAAACCTGCAGGAAGG + Intergenic
987316578 5:16730159-16730181 CCATTTTGTAACCTTGAGGAAGG + Intronic
987484192 5:18503062-18503084 CCATGTGGCTATTTGGAGGAAGG - Intergenic
987485452 5:18520429-18520451 GCAGTTTGTAACCTGGAGGAAGG - Intergenic
988095612 5:26605614-26605636 TCATGTGGTAACATGAGGGATGG - Intergenic
989182722 5:38594828-38594850 CTCTGTGGAAACCTAGAGGAAGG - Intronic
989283301 5:39669576-39669598 CCAAGTGGTAACATCAAGGATGG - Intergenic
989478365 5:41900371-41900393 CCATATGGAAACATGGGGGAAGG + Intergenic
989607109 5:43255160-43255182 CTCTGTGGTAACATGGAAGATGG + Intronic
990699884 5:58462932-58462954 CAATTTGGTAACCAGTAGGAAGG + Intergenic
993127027 5:83847816-83847838 CCATGTGGATATCTGGAGGAAGG - Intergenic
993889571 5:93457206-93457228 CCATGTGGTAATCTGAAATATGG - Intergenic
994261533 5:97665208-97665230 CCATGTGGTAAGCTTGAGGTTGG - Intergenic
995024027 5:107398314-107398336 CTCTGTGGGAACCTGGAAGAGGG - Intronic
997203989 5:132030737-132030759 GAATGTGGTAAGCTGGAGGTCGG + Intergenic
997640279 5:135444428-135444450 CCATGAGGGAAGCTGGAGGGAGG + Exonic
998526523 5:142847824-142847846 CCATCTGGACACCTGGAGGTGGG + Intronic
1001682441 5:173568862-173568884 CCATGAGGCAAACTAGAGGATGG - Intergenic
1003470168 6:6422141-6422163 CCTTGGGTTAACATGGAGGAAGG - Intergenic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1004638827 6:17494452-17494474 CCATGTAGACATCTGGAGGAAGG - Intronic
1004874018 6:19937102-19937124 CAATGTGGAAACCTGGAAAAAGG - Intergenic
1006940058 6:37746010-37746032 CCATGAGGTAACCTTGGGAATGG + Intergenic
1007996991 6:46318099-46318121 CCATGTGGTGACATGTGGGATGG + Intronic
1010060266 6:71614732-71614754 CCATGAAGTTATCTGGAGGAAGG - Intergenic
1010617086 6:78026528-78026550 GCATTTAGTAACCTGGAGTAGGG + Intergenic
1011382138 6:86753631-86753653 CTATGTAGTCACCTGAAGGAGGG - Intergenic
1012267945 6:97169863-97169885 CCATGTGGTACCCTATAGCACGG - Intronic
1013725922 6:113095693-113095715 CCATGTGCTAGACAGGAGGAAGG + Intergenic
1015392774 6:132701796-132701818 CCATGTGGTAACCTGGAGGATGG - Intronic
1017291571 6:152744276-152744298 CAATGTGGGAACTTGGAGGAAGG - Intergenic
1018334096 6:162765513-162765535 CCATGTGGGAACATGGAAAAGGG + Intronic
1019980704 7:4619913-4619935 CCATGAGGTAACCTTGAGAATGG + Intergenic
1020186841 7:5965605-5965627 CCATTTGAGAACCTGCAGGAAGG - Intronic
1020296075 7:6759169-6759191 CCATTTGAGAACCTGCAGGAAGG + Intronic
1021237858 7:18165263-18165285 TCGTGTGGTAGCCTGGGGGAAGG + Intronic
1022480395 7:30739780-30739802 CCTGGTGGGAGCCTGGAGGAGGG + Intronic
1022981069 7:35605464-35605486 CCATATGGAAACCAGGAAGAAGG + Intergenic
1023165156 7:37336307-37336329 CCATATGTTAACCTGAAGAAAGG - Intronic
1028226454 7:88257612-88257634 ACATGTCTAAACCTGGAGGATGG + Intergenic
1031548237 7:123076798-123076820 CCATGTGATAACAGGGAAGACGG + Intergenic
1032506232 7:132436627-132436649 CCATGTAGCAACTTGGAGGAGGG - Intronic
1032838801 7:135697868-135697890 CCATGTGGAAACCTGAAGGACGG - Intronic
1035581545 8:743202-743224 ACATGTGATAACCATGAGGATGG + Intergenic
1035761203 8:2070133-2070155 CCATGAGGGCATCTGGAGGACGG + Intronic
1037472067 8:19220509-19220531 CCATGTGTCAACCTGGTGGGAGG - Intergenic
1037987556 8:23299324-23299346 CGGTGTGGGAACCTGGAAGAGGG + Intronic
1039566345 8:38554759-38554781 CCATGTTGGAGCCTGGGGGATGG + Intergenic
1041268004 8:56083676-56083698 CCATGCAGTAATCTGGGGGAGGG + Intergenic
1046878018 8:119277593-119277615 CCATGTGGTGGTCTGGAGGATGG + Intergenic
1051044272 9:12854887-12854909 CCATGTTGAAACCTTGTGGAAGG + Intergenic
1053644588 9:40112993-40113015 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1053761394 9:41351858-41351880 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1054350167 9:64013403-64013425 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1054539988 9:66262976-66262998 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1055369734 9:75584324-75584346 CCATTTGGTACCTTGGAGGCTGG + Intergenic
1056234710 9:84583123-84583145 CCATGTGTTTACCTGTAGGCAGG - Intergenic
1056266638 9:84903342-84903364 CCATGAGGTGATCTTGAGGATGG + Intronic
1056320101 9:85427696-85427718 CCATGTGGTAGCGGAGAGGAAGG - Intergenic
1056709504 9:88979290-88979312 CCCTTGGGTAAGCTGGAGGAAGG - Intergenic
1056820769 9:89840415-89840437 CCGTGGGGTAGCCTTGAGGAAGG + Intergenic
1059045514 9:110861955-110861977 CCATTTTGTCATCTGGAGGATGG - Intergenic
1059843290 9:118242801-118242823 CCATTTGGGGGCCTGGAGGATGG + Intergenic
1060586936 9:124792533-124792555 GCATGTGCTGGCCTGGAGGAGGG + Intronic
1062394038 9:136345557-136345579 CCATGCGGTGTCCTGGTGGAGGG + Intronic
1202792148 9_KI270719v1_random:95153-95175 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1186838357 X:13460025-13460047 CCATGTTGAAACATGGAGGCAGG - Intergenic
1187821292 X:23290900-23290922 CCCTGAGGTAACATGGAGCACGG - Intergenic
1188114199 X:26223568-26223590 CAATGTGGGCACCTGAAGGAGGG - Intergenic
1192079509 X:68033235-68033257 CCATTTGGGAACCTGGGGAATGG + Intergenic
1192205340 X:69092120-69092142 CTATGTGGGAATCTGGGGGAAGG + Intergenic
1192332501 X:70187759-70187781 CCAAGTGGTAGCATGGAGGTGGG + Intronic
1192887602 X:75352156-75352178 TGATGTGGTAATTTGGAGGAAGG + Intergenic
1194352663 X:92839965-92839987 CCATTCGGGAACCTGGAGGATGG + Intergenic
1195315662 X:103675086-103675108 CCATGTGATGACAAGGAGGACGG + Intergenic
1196605615 X:117654303-117654325 CCATTTTGGAATCTGGAGGATGG + Intergenic
1197246539 X:124172594-124172616 CCAGGTGGTGACTTGGAGGCTGG + Intronic
1197333184 X:125179966-125179988 CCAGGTGGTAGTATGGAGGATGG - Intergenic
1198577310 X:138024788-138024810 ACAGGTGGCAACTTGGAGGAAGG - Intergenic
1198649267 X:138843274-138843296 CTATGTGGTAACCTAGAGAAAGG - Intronic
1198693124 X:139306179-139306201 CTATGTTCTAACATGGAGGAAGG + Intergenic
1199293418 X:146130642-146130664 CTATGTGCTAATCTGGAGGTGGG - Intergenic
1200660968 Y:5956707-5956729 CCATTCGGGAACCTGGAGGATGG + Intergenic