ID: 1015392776

View in Genome Browser
Species Human (GRCh38)
Location 6:132701800-132701822
Sequence CACACCATGTGGTAACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392776_1015392783 2 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392776_1015392782 1 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392776_1015392784 6 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392776_1015392787 24 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392776_1015392781 0 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392776_1015392780 -1 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392776_1015392788 25 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392776 Original CRISPR CACACCATGTGGTAACCTGG AGG (reversed) Intronic
901216012 1:7555790-7555812 CAGACCTAGTGGTGACCTGGGGG - Intronic
901938539 1:12644728-12644750 CAGGCCACGTCGTAACCTGGGGG + Intronic
908582572 1:65531262-65531284 CGAACCATGTGGAAATCTGGAGG - Intronic
910450422 1:87337859-87337881 CACACCATGTGGGAGCTTGGGGG - Intronic
913077324 1:115352158-115352180 CACACCATGCAGGACCCTGGAGG - Intergenic
913427638 1:118751992-118752014 CACACCGTGTGGAAAACTGCAGG - Intergenic
914214278 1:145610457-145610479 CACACTGTGTGGAAATCTGGAGG - Intronic
914466217 1:147930859-147930881 CACACTGTGTGGAAATCTGGAGG - Intronic
919490334 1:198198119-198198141 CCCACCATAGGGTACCCTGGAGG - Intronic
921312130 1:213855012-213855034 CACACCATGTCCTCACATGGTGG + Intergenic
923024004 1:230189933-230189955 CACAACATGGGTGAACCTGGAGG - Intronic
923402916 1:233632621-233632643 CACACTATGTGGTCACCGAGTGG - Intronic
923477890 1:234353832-234353854 TACACCATGAGGTAAACTTGGGG + Intergenic
924359138 1:243217791-243217813 CACACCAGGTAGAGACCTGGTGG + Intronic
1063388756 10:5634715-5634737 CTCATCATGTGGTGAGCTGGGGG - Intergenic
1068334849 10:55621467-55621489 CACAGCAGGTGGTGACCTGCGGG + Intronic
1068527448 10:58146528-58146550 AACACTATGTGGTGAGCTGGAGG + Intergenic
1070849216 10:79550058-79550080 CAGACCATGTGGGACCCTGATGG + Intergenic
1072865079 10:99050708-99050730 GACACCATGGGTGAACCTGGAGG + Intronic
1076469821 10:130710540-130710562 CACAGCAAGTGGTACCCGGGAGG + Intergenic
1077396538 11:2326443-2326465 CAGGCCATGTGGTAACTTGGTGG - Intergenic
1086498069 11:87424525-87424547 CACACCATGTGGTATGATGAAGG + Intergenic
1087016478 11:93559250-93559272 CACTCCATGTGGCTTCCTGGTGG + Intergenic
1092203255 12:6600272-6600294 CAGACCATGTGGTAAGCACGGGG + Exonic
1093164596 12:15789959-15789981 CAACCCATGCGGTAAACTGGTGG + Intronic
1094707633 12:32929772-32929794 CACACCATGGAGGAACCTCGAGG - Intergenic
1097699849 12:62808815-62808837 CCCACCAGGTGGTAAAATGGAGG - Intronic
1097971996 12:65643280-65643302 CACAACATGAGTAAACCTGGTGG - Intergenic
1100165666 12:91914810-91914832 AACAACATGTAGTAACCTTGCGG - Intergenic
1100225074 12:92548315-92548337 CACCCCATCTGGTAACCTGGAGG - Intergenic
1102256770 12:111419855-111419877 AACCTCATGTGGTATCCTGGGGG - Intronic
1103047346 12:117748151-117748173 GACACCATGAGTGAACCTGGAGG + Intronic
1103978109 12:124717035-124717057 CACACCCTGTGGGAGCCAGGAGG - Intergenic
1104070037 12:125336670-125336692 CACACCATGAGGTAACCCAGTGG - Intronic
1104409259 12:128544220-128544242 CCCACCACGTGGAAATCTGGAGG + Intronic
1113348796 13:109508116-109508138 CACAGGATGTGGTCTCCTGGTGG + Intergenic
1113725139 13:112592823-112592845 CACACCATGAGGCAGCCAGGTGG + Intergenic
1114923734 14:27366225-27366247 CACAACATGGATTAACCTGGAGG + Intergenic
1117338562 14:54775198-54775220 CCCACCCTGGGGTCACCTGGGGG - Intronic
1119700921 14:76754069-76754091 CACATCTTGTGGTTAGCTGGTGG + Intergenic
1120100826 14:80443892-80443914 AACAACATGGGTTAACCTGGAGG + Intergenic
1120945563 14:89992753-89992775 CAGACCATCTGTTAATCTGGAGG + Intronic
1123034159 14:105465072-105465094 CACACCGTGTGGTACCCCGCAGG + Exonic
1124372256 15:29110504-29110526 CCCACCATGGGGTGGCCTGGGGG + Intronic
1126375863 15:47996092-47996114 CACACCTTGTGGTAACCACATGG + Intergenic
1131517931 15:93091622-93091644 CACACCAGGTGGCATCCAGGTGG - Intergenic
1131729727 15:95267248-95267270 CACACCTTGTGGTAACCCTTGGG + Intergenic
1131801514 15:96074224-96074246 CACACCATGGTGAAACCTAGCGG + Intergenic
1134234408 16:12454216-12454238 TGGGCCATGTGGTAACCTGGGGG + Intronic
1137635024 16:49978438-49978460 CATGCCATGTGGTTACCTAGGGG - Intergenic
1138299006 16:55910870-55910892 CACAGCATGTGGAAGACTGGAGG + Intronic
1138984820 16:62315467-62315489 CACATTATGTGGAAAACTGGAGG + Intergenic
1139956472 16:70695610-70695632 CACACCCAGTGGGGACCTGGAGG - Exonic
1145191681 17:20846487-20846509 CACAGCAGGTGGTGACCTGCGGG + Intronic
1152369471 17:79877514-79877536 CACAACATGTGGTAAGCTAGTGG - Intergenic
1153978623 18:10290782-10290804 GACACAATGGGCTAACCTGGTGG + Intergenic
1156381719 18:36567826-36567848 CTCACCATGGGATTACCTGGGGG - Intronic
1157265638 18:46218366-46218388 CACACCATTTAGTAACTTTGTGG + Intronic
1160599724 18:80003320-80003342 CACACCCTGAAGTCACCTGGTGG - Intronic
1161315471 19:3615330-3615352 CACACCACGTGGCATCCCGGCGG + Intronic
1161684383 19:5695770-5695792 CCCACCATGGGGCAGCCTGGAGG + Intronic
1162799016 19:13100992-13101014 TACACCAGGTGGCAGCCTGGGGG + Exonic
1163455720 19:17404670-17404692 CACCCCACGTGGAAACTTGGAGG + Intronic
1166519199 19:43468538-43468560 CACACCATGAGGTAACTGTGAGG - Intergenic
925775844 2:7335021-7335043 AACACCATGTGGGAAACAGGAGG - Intergenic
927684945 2:25164015-25164037 TACACCCTGTGGTGACCTGGAGG + Intronic
929393104 2:41494328-41494350 CACACCATGGTGTTACCTGAAGG + Intergenic
930470965 2:51812665-51812687 CACACAATGAGGTTACTTGGAGG - Intergenic
930481173 2:51950261-51950283 AACAACATGGGCTAACCTGGAGG - Intergenic
934311767 2:91873582-91873604 GACACCAAGTAGTCACCTGGTGG + Intergenic
935540269 2:104340083-104340105 AACAACATGGGGGAACCTGGAGG - Intergenic
935796925 2:106651640-106651662 CACACCATGTGTTCACTTTGTGG - Intergenic
939897401 2:147808683-147808705 CACGTCATGTGGCACCCTGGAGG - Intergenic
944045353 2:195404704-195404726 GACAACATGGGTTAACCTGGAGG + Intergenic
946572825 2:221043149-221043171 CAGACCATGTGGAAGCTTGGTGG - Intergenic
1169425980 20:5497751-5497773 CATACCAGGTGGACACCTGGAGG + Intergenic
1169539158 20:6580971-6580993 GCCCCCATGTGGTATCCTGGAGG - Intergenic
1171957744 20:31472940-31472962 CACACGATGTTGTTACCTGATGG + Exonic
1175974439 20:62703351-62703373 CACACCATGTGGACAGCAGGCGG + Intergenic
1176887142 21:14270292-14270314 CACACCATGTTTTCACATGGTGG - Intergenic
1178372178 21:32035548-32035570 TACACCCTGAAGTAACCTGGTGG - Intronic
1181667300 22:24407077-24407099 CACCCTATGTGATAAGCTGGAGG - Intronic
950218244 3:11174963-11174985 CACACCAAGTGGGACCCTGTTGG - Intronic
952862542 3:37825927-37825949 CAGACCATGAGGCAACCTTGAGG - Intergenic
954198964 3:49013035-49013057 CACACCAGGAAGTCACCTGGGGG - Exonic
954421718 3:50422341-50422363 AACAGCCTGTGGCAACCTGGGGG - Intronic
956149400 3:66225126-66225148 TCCACCAGGTGGTGACCTGGTGG + Intronic
956235665 3:67068437-67068459 CACAACATGTGATAACCTTGTGG - Intergenic
957938630 3:86976267-86976289 CTCATCATGTGGTTACCTAGGGG - Intronic
961883741 3:130081840-130081862 GACACCAGGAGGTAACCAGGTGG + Exonic
962375825 3:134857962-134857984 CACAGCTTGTGGTAACAGGGGGG - Intronic
969962187 4:10956222-10956244 GACAGCATGTGTGAACCTGGAGG + Intergenic
971776263 4:30970053-30970075 CACCCAATGTGTTATCCTGGTGG + Intronic
972464300 4:39339042-39339064 CACAGCATGTGTGAACCCGGCGG - Intronic
976021188 4:80629158-80629180 AACAACATGTATTAACCTGGAGG + Intronic
980229687 4:130033335-130033357 CATAGCATGTGGTCATCTGGGGG - Intergenic
984088388 4:175340286-175340308 GTTTCCATGTGGTAACCTGGAGG - Intergenic
985383071 4:189415960-189415982 CTCATCATGAGGTTACCTGGTGG + Intergenic
986744657 5:10733087-10733109 CACGTCATGGGGGAACCTGGAGG - Intronic
988254831 5:28808574-28808596 CGCACCATCTGGTTTCCTGGGGG + Intergenic
991610168 5:68441508-68441530 CACACCAGGTGTTAACCAAGGGG - Intergenic
994245325 5:97470655-97470677 CCCACCATGTGGCAAGCAGGGGG + Intergenic
994611152 5:102041761-102041783 GACACCATGGGTAAACCTGGAGG + Intergenic
1000717495 5:164664317-164664339 AACAACATGTGTGAACCTGGAGG + Intergenic
1008195258 6:48511307-48511329 CACCCCTTGTGGTACCCTTGTGG - Intergenic
1008506711 6:52237748-52237770 CACACCCTCAAGTAACCTGGTGG - Intronic
1009615637 6:66001558-66001580 GACAACATGTGTGAACCTGGAGG - Intergenic
1014895661 6:126896639-126896661 CAGATCATATGGTAACTTGGTGG - Intergenic
1015392776 6:132701800-132701822 CACACCATGTGGTAACCTGGAGG - Intronic
1016735017 6:147468837-147468859 TACACCTTGTGGTCACTTGGGGG + Intergenic
1017460687 6:154646743-154646765 CACACCTTCTAGTCACCTGGGGG + Intergenic
1032284927 7:130532656-130532678 CACACCATGTGGAAACATTCTGG - Intronic
1032626330 7:133595210-133595232 CAGAGCAAGTGGTATCCTGGAGG + Intronic
1039624943 8:39039687-39039709 CACAACATGGAGGAACCTGGAGG - Intronic
1046518834 8:115298848-115298870 CACAACATGTAGGAAACTGGAGG - Intergenic
1051529553 9:18084996-18085018 CAAACCATGTGGGTATCTGGAGG + Intergenic
1051711586 9:19935778-19935800 CTCACCATGTTTTAACTTGGTGG - Intergenic
1054837373 9:69692030-69692052 CACAACATGGAGTAACCTGGAGG - Intergenic
1057266060 9:93619036-93619058 CCCACCATGTGGTACACTGGGGG + Intronic
1057446242 9:95117159-95117181 CACAGAATGTGGGATCCTGGGGG + Intronic
1059867205 9:118528829-118528851 CACCCCATGAGGAAAGCTGGAGG + Intergenic
1061614070 9:131767899-131767921 CACGCCCTGTGGTACCCTGGAGG - Intergenic
1186865969 X:13721168-13721190 CACACCGTGGGGTTACCTTGGGG - Intronic
1187734383 X:22289540-22289562 AACACCATGTGGAAAGCTTGGGG - Intergenic
1188346269 X:29069870-29069892 CACCCCATGTGTTAACTTGATGG - Intronic
1193975065 X:88108167-88108189 CACACCATATCGTAACCTTCTGG + Intergenic
1200048759 X:153417239-153417261 GACACCACGTGGGACCCTGGAGG - Intergenic
1200819464 Y:7567706-7567728 CACAGCATGTGGAATGCTGGGGG - Intergenic