ID: 1015392778

View in Genome Browser
Species Human (GRCh38)
Location 6:132701803-132701825
Sequence CTCCACACCATGTGGTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392778_1015392784 3 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392778_1015392781 -3 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392778_1015392782 -2 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414
1015392778_1015392788 22 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392778_1015392780 -4 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392778_1015392787 21 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392778_1015392783 -1 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392778 Original CRISPR CTCCACACCATGTGGTAACC TGG (reversed) Intronic
902720285 1:18299818-18299840 TTCCACCCCAAGTGGGAACCTGG + Intronic
903060651 1:20666389-20666411 CTCCACAGCCTCTGGTATCCTGG + Intronic
907072294 1:51547242-51547264 CTCCTCTCCATATGATAACCAGG - Intergenic
1075092194 10:119450122-119450144 CTCAACACTATGTGGTTTCCTGG - Intronic
1075579943 10:123609843-123609865 CTGCATCCCATGTGGAAACCAGG + Intergenic
1077582359 11:3424567-3424589 ATCCACAGCATGTCCTAACCTGG + Intergenic
1083301283 11:61740781-61740803 CTCCCCACCATGGGGCAACGTGG - Intronic
1084649791 11:70482458-70482480 CTCCTCACCTTGTGGGAGCCAGG - Intronic
1091982533 12:4877939-4877961 CACCACAACATGTGATAACTGGG + Intergenic
1093164594 12:15789956-15789978 CTCCAACCCATGCGGTAAACTGG + Intronic
1100225075 12:92548318-92548340 CCTCACCCCATCTGGTAACCTGG - Intergenic
1101555174 12:105802115-105802137 CTCCTCAGCACGTGGTTACCAGG - Intergenic
1102643237 12:114385014-114385036 CTTGACACCATGTGGTGTCCAGG - Intronic
1102727147 12:115075684-115075706 CTCCATACCATGTGGTTAGCTGG + Intergenic
1103063119 12:117875013-117875035 CTCCACACCAGGGGGCAGCCTGG + Intronic
1105006449 12:132723975-132723997 CTCCACTCCAAGTCCTAACCAGG + Intergenic
1105287997 13:19023113-19023135 TTCCACACTATGTTGTAGCCAGG - Intergenic
1108850515 13:54722575-54722597 TGCCACAACATGTGCTAACCTGG - Intergenic
1112144792 13:96686907-96686929 CTCCAAAACATGTGATAATCAGG + Intronic
1115538516 14:34396410-34396432 CTCAACACCATTTGTTAAACAGG - Intronic
1117338567 14:54775201-54775223 CTCCCCACCCTGGGGTCACCTGG - Intronic
1121712014 14:96045488-96045510 CTCCACTCCATGAGGTCACCTGG - Intronic
1124400640 15:29344876-29344898 CTCCTCACCATGAGTTTACCTGG - Intronic
1142542785 17:673675-673697 CTCCACACCACTTAGGAACCTGG + Intronic
1148354554 17:46967190-46967212 CTCCAAACCAGGAGGTAACACGG - Intronic
1154337796 18:13479833-13479855 CTCCACACCATATGTTATCAGGG + Intronic
1161278602 19:3433287-3433309 TTCCACAGCATGGGGGAACCCGG + Intronic
1161315468 19:3615327-3615349 CCCCACACCACGTGGCATCCCGG + Intronic
1161477219 19:4493522-4493544 CTCCACCCCAAGTGAAAACCGGG - Intronic
1162643067 19:12027943-12027965 CTACAAACCATGTACTAACCTGG + Intronic
1163757850 19:19117313-19117335 CTCAACACCGTGTGGTGCCCAGG - Intergenic
1164527456 19:29022519-29022541 CTCCCCACCATGTGCTCACCTGG - Intergenic
928509034 2:31984472-31984494 CTAAACACGATGTGGTAACCTGG + Intronic
933295539 2:80486886-80486908 CTACACACAATGTGGGATCCGGG - Intronic
936932359 2:117803172-117803194 CTACATACAATATGGTAACCTGG + Intergenic
938388768 2:130887784-130887806 GTCCTCACCATGTGGTCTCCAGG + Intronic
941688428 2:168471275-168471297 CAACAGACCATCTGGTAACCAGG - Intronic
947489176 2:230579093-230579115 CTCCACACCATGAGATAATCAGG + Intergenic
1169000876 20:2167185-2167207 CTCCACAGGATGTGGAAATCAGG + Intronic
1169326937 20:4684187-4684209 CACCAGACCATGAGGAAACCAGG + Intergenic
1169718465 20:8645623-8645645 CTCCATACCATGTAGTCACAAGG - Intronic
1172656504 20:36541551-36541573 CTCCGCACCAGGTGGGATCCGGG + Exonic
1174775218 20:53337484-53337506 CTCCAGCCTCTGTGGTAACCAGG - Intronic
1185064119 22:48622171-48622193 CTTGACACCATGTGGTATTCAGG + Intronic
950069959 3:10143812-10143834 CTCCAAACCACTTGGCAACCTGG - Intronic
950275465 3:11656730-11656752 CTCCATACCATGTGAGAACCAGG + Intronic
950368955 3:12511125-12511147 CTCCACTCCAAGTACTAACCAGG + Intronic
958933635 3:100234086-100234108 CTCCACACCATGTGACAGCTAGG + Intergenic
962605066 3:137026141-137026163 CTACACCCCAGGAGGTAACCTGG - Intergenic
963039914 3:141062066-141062088 TTCCACATAATGTGGTATCCTGG - Intronic
965309892 3:167115603-167115625 CTACAGACCAAGTGGAAACCTGG - Intergenic
971124659 4:23740181-23740203 CTGCAGACCATGTGGTTTCCAGG - Intergenic
973759260 4:54101510-54101532 TCCCACCCCATGTGCTAACCAGG - Intronic
975736194 4:77383495-77383517 CTCCTAATCATGAGGTAACCTGG - Intronic
979526415 4:121722110-121722132 CTCCACCCCACGTGGCATCCTGG - Intergenic
981858858 4:149329962-149329984 ATCCACACCACATGGTTACCTGG + Intergenic
986428459 5:7657749-7657771 CTCCTCACCATGAGGTTTCCGGG + Intronic
990660854 5:58013637-58013659 CTCAACTCCATGAGGTAAACTGG + Intergenic
994062564 5:95496384-95496406 CTCCCCTCCTTGTGTTAACCTGG - Intronic
998202454 5:140135868-140135890 CTGCCCACCATGTGGCAGCCTGG - Intergenic
1000253851 5:159519638-159519660 CTCCTCACCATGTGGCGGCCAGG + Intergenic
1000887474 5:166763613-166763635 CTCCACAACATGAGGAAGCCTGG + Intergenic
1003083165 6:3038461-3038483 CTCCACACCATGCAGTAGCTGGG + Intergenic
1004423102 6:15488889-15488911 GGCCACACCATGTGCTCACCTGG + Intronic
1006412047 6:33879524-33879546 CTCAACGCCATCTGGTAGCCTGG - Intergenic
1006748163 6:36359781-36359803 CTCAACTCCATGTGCTAAGCAGG + Intronic
1010145824 6:72668749-72668771 CTCCCCACCATGTGAGAACATGG + Intronic
1015000536 6:128209168-128209190 TTCCACATCATCTGGTATCCTGG + Intronic
1015392778 6:132701803-132701825 CTCCACACCATGTGGTAACCTGG - Intronic
1021777537 7:24068319-24068341 CTCCAAACCATGTGGGAGGCAGG - Intergenic
1021963794 7:25897691-25897713 CCCTGCACCATGTGGTAAGCTGG - Intergenic
1030250497 7:107438900-107438922 CTCCAGACCATGTGGTAGAAGGG - Intronic
1030639151 7:111984657-111984679 CTCCACACCATGTGGTGCTAAGG - Intronic
1035303142 7:157910597-157910619 CACCACACCATGTGGGAAAGAGG - Intronic
1035333644 7:158112382-158112404 CTCCTCACCATGTGGCACCGCGG - Intronic
1043220474 8:77655931-77655953 CTCCATGCCCTCTGGTAACCGGG - Intergenic
1043776643 8:84278200-84278222 CTCAACACCATGTGTAAACCAGG + Intronic
1044934683 8:97281986-97282008 TTCCATACCCTTTGGTAACCTGG - Intergenic
1049312868 8:141942731-141942753 CACCACACCCTGTGGGGACCTGG - Intergenic
1049676097 8:143889915-143889937 CTCCACAGCCCGTGGTCACCCGG - Intergenic
1052963446 9:34319874-34319896 CTCCACATCCTGTGGTACCTGGG + Intronic
1052997008 9:34556384-34556406 CTCCAGAAAATGTGGTAGCCCGG - Exonic
1057908782 9:99002371-99002393 CTCCAAACCATTTGGTGAGCTGG - Intronic
1062142189 9:134965661-134965683 GTCCACACCATGTGGGCCCCTGG - Intergenic
1189999410 X:46671189-46671211 CTAAACGCCATGTGGTATCCCGG - Intronic
1193917491 X:87383021-87383043 CTCCACAACATGTGGGAATTAGG - Intergenic
1194066843 X:89271390-89271412 CCCCACACCCTGTTGCAACCGGG - Intergenic
1202168263 Y:22015131-22015153 CACCACACCATGAGGGAGCCAGG + Intergenic
1202223098 Y:22571237-22571259 CACCACACCATGAGGGAGCCAGG - Intergenic
1202320017 Y:23624423-23624445 CACCACACCATGAGGGAGCCAGG + Intergenic
1202550751 Y:26045633-26045655 CACCACACCATGAGGGAGCCAGG - Intergenic