ID: 1015392779

View in Genome Browser
Species Human (GRCh38)
Location 6:132701811-132701833
Sequence AATTTTCTCTCCACACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 10, 3: 38, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392779_1015392784 -5 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392779_1015392789 26 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392789 6:132701860-132701882 GTGATTGTGGGACTTTACATTGG 0: 5
1: 60
2: 140
3: 186
4: 283
1015392779_1015392787 13 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392779_1015392788 14 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392779_1015392783 -9 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392779_1015392782 -10 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG 0: 2
1: 0
2: 9
3: 93
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392779 Original CRISPR AATTTTCTCTCCACACCATG TGG (reversed) Intronic
904923049 1:34023753-34023775 AATTTTCTCTCCATTTCAAGAGG - Intronic
905024852 1:34843022-34843044 ACTTTCCTCCCCACACCATGGGG + Intronic
905837940 1:41145053-41145075 ATTTTTGTTTCCACACCATCAGG - Intronic
906785220 1:48609771-48609793 AATTCTCTCCCCACTGCATGCGG + Intronic
907078964 1:51603964-51603986 AATTTTCTCACCCCTCCATTGGG - Intronic
909309704 1:74130445-74130467 GATTCTCTTTCCACGCCATGTGG + Intronic
909341628 1:74538495-74538517 CATATTCTTTCCACACAATGAGG - Intronic
910147985 1:84105310-84105332 AAGTTTCTCTCCATAACAAGGGG - Intronic
911120925 1:94295708-94295730 AATTCTAACTCCACACAATGTGG + Intergenic
914989601 1:152486829-152486851 AATTTTATCTCCACCTCAGGTGG + Intergenic
915298744 1:154940203-154940225 ACTTTCCTCTCCACAGCATGTGG + Intergenic
916360466 1:163962091-163962113 CAGATTCTCTCCACACTATGTGG - Intergenic
917191244 1:172421813-172421835 GATTCTCTCTCCACACTATGTGG - Intronic
917288009 1:173441793-173441815 ACTACTCTCTCCACACCATGGGG - Intergenic
918245421 1:182655346-182655368 TATTTTCTCTCCACCCCACCTGG - Intronic
921061619 1:211589990-211590012 ATTTTTTTCTCTACTCCATGTGG - Intergenic
921552605 1:216556118-216556140 AATTTTCTCACAAAACCACGAGG + Intronic
921976925 1:221213129-221213151 ACTTTTCCCTCCCCACCCTGTGG + Intergenic
922146416 1:222949953-222949975 AATAGTCTCTCCTCACCATGAGG + Intronic
924197369 1:241622181-241622203 ATTTTTGTCTCAACTCCATGAGG - Intronic
1063536999 10:6893120-6893142 AATTAGCTCTCCAGTCCATGAGG + Intergenic
1066182511 10:32976999-32977021 AATTTTCTGCCCACCCCATTGGG - Intronic
1066527503 10:36297134-36297156 GATTCTCTCTCTGCACCATGTGG + Intergenic
1066544987 10:36489965-36489987 AATTTTCTCTCCAAGCCCAGTGG + Intergenic
1069299175 10:66885142-66885164 ACTTATCTTTCCACACGATGAGG - Intronic
1070348727 10:75571330-75571352 AATGTGTTCTCCACACAATGTGG - Intronic
1071418571 10:85464550-85464572 AATTTTCTCTCAAGGCCCTGGGG - Intergenic
1071754182 10:88517819-88517841 AATTTTCTCTCCAAACCTTCTGG - Intronic
1072904164 10:99435731-99435753 ACTATTCTCTCCACATCCTGGGG + Intergenic
1074570311 10:114618416-114618438 AATTTTCTCTCCACATCAGGAGG - Intronic
1075550912 10:123391684-123391706 AGTTTTCTATCCAGACCACGTGG + Intergenic
1075830652 10:125408097-125408119 GATTCTCTCTCCATGCCATGCGG + Intergenic
1079976197 11:27094419-27094441 CATTTTCTTTCAACATCATGTGG - Intronic
1080350997 11:31385907-31385929 GATTCTCTTTCCACGCCATGTGG - Intronic
1080586079 11:33683810-33683832 AATTTTCTCTCTTCCCCCTGGGG - Intergenic
1080984952 11:37451619-37451641 AATTCTTTCTCCAAACTATGAGG - Intergenic
1083773673 11:64882545-64882567 AGTGTCCTCTCCACACCATGAGG + Intronic
1084155553 11:67310846-67310868 AATTTAGCCTCCCCACCATGGGG - Intronic
1084526089 11:69698792-69698814 AAATTTCACTCAACCCCATGTGG - Exonic
1084673863 11:70623191-70623213 AAATTCCTCTCCACATCCTGTGG + Intronic
1085562655 11:77486595-77486617 GATTCTCTCTCCATGCCATGTGG - Intergenic
1085736100 11:79040566-79040588 TGTTTTCTCTCCACTCCATATGG - Intronic
1087032143 11:93716319-93716341 GATTCTCTCTCCGCACCATGTGG + Intronic
1087393296 11:97566968-97566990 ATTTTTCCCTCCACATCCTGGGG - Intergenic
1087653282 11:100893305-100893327 TATTTTCTCTCCATATCATGAGG - Intronic
1087780151 11:102292925-102292947 AATTTTCTCACCATAAGATGAGG + Intergenic
1087799243 11:102486215-102486237 AATTTTATCTCTACTCCCTGGGG - Intronic
1087971991 11:104495527-104495549 AATTTTCTCCCCACAAGATTTGG + Intergenic
1088274447 11:108069835-108069857 ATTTTTCTCTCCCCTCCTTGAGG + Intronic
1089938137 11:122386748-122386770 AATTTTCTTCCCACAGCATGAGG - Intergenic
1090571001 11:128045312-128045334 AATTTACTCACCACCCCATATGG - Intergenic
1091444547 12:536002-536024 AATTTTCTGTCCTCCCCATATGG - Intronic
1093131879 12:15401589-15401611 AATTTGCTATCCACAACATATGG + Intronic
1093258391 12:16902051-16902073 TATTTTCTTTCCACTGCATGAGG + Intergenic
1097463666 12:59895374-59895396 AATTTTCTCCCCAAACCATCTGG - Intergenic
1097707208 12:62880647-62880669 AATTTTCTCTTCCCAGCCTGGGG - Intronic
1098046590 12:66407503-66407525 GTTTTTCTCTCCATGCCATGTGG - Intronic
1098667485 12:73181497-73181519 GATTATCTCTTCGCACCATGTGG + Intergenic
1099781566 12:87202293-87202315 GATTATCTCTCCACACCACACGG - Intergenic
1099967261 12:89461960-89461982 AATTTTCTGTCTACACTAGGTGG - Intronic
1100381105 12:94062760-94062782 TATTTTCTCTCTGCACCAGGTGG - Intergenic
1100758607 12:97780284-97780306 AATTAACTCTCCACAGTATGTGG + Intergenic
1101607366 12:106257856-106257878 GATTCTCTCTCCTCACCACGAGG - Intronic
1105827336 13:24134184-24134206 GAATTTCTCTCCCCAGCATGAGG + Intronic
1107804923 13:44144585-44144607 AATTGTCTTTGCATACCATGTGG - Intronic
1108519229 13:51230951-51230973 AATATTCGCACAACACCATGGGG - Intronic
1108857928 13:54819235-54819257 GATTCTCTCTCCACACCATGGGG - Intergenic
1109489343 13:63075595-63075617 AATTCTCTGTCCACACAAAGTGG + Intergenic
1110009041 13:70308269-70308291 AATATTCTCTCCACAGGATCAGG + Intergenic
1110183662 13:72647010-72647032 ATTTTTCTCTCCTATCCATGTGG - Intergenic
1111085926 13:83374700-83374722 AATTCTCTCTCCACACCACATGG + Intergenic
1112844369 13:103620318-103620340 AATTTTCTCTCCTTAGCCTGAGG + Intergenic
1113699607 13:112374878-112374900 AATATACTCCCCACACCTTGAGG + Intergenic
1115501247 14:34051760-34051782 AATTTTCCCTCCATATGATGGGG - Intronic
1115805093 14:37041980-37042002 ATTTTTCTCACCACATCAAGTGG + Intronic
1115875161 14:37853193-37853215 AATTTTCTTTCCAGAGCATTTGG + Intronic
1117161625 14:52995378-52995400 GATTCTCTCTCTGCACCATGTGG + Intergenic
1119001797 14:70888807-70888829 AATTTTCTCTCCTCACCCTGAGG - Intergenic
1119956991 14:78809298-78809320 AATTTTCTCTCCTCAAGATGTGG + Intronic
1121418537 14:93796114-93796136 AGTATACTCCCCACACCATGGGG + Intergenic
1124426628 15:29568914-29568936 AGTTCTCTCTCCACACCCTTGGG + Intronic
1126885199 15:53141662-53141684 AATTTACTCGCTACAGCATGAGG - Intergenic
1131315242 15:91329799-91329821 GATTCTCTGTCCACGCCATGTGG + Intergenic
1133621330 16:7529465-7529487 AATTTCCTGTCCACAGGATGTGG + Intronic
1134609906 16:15599605-15599627 AATTTTGTCTTCATAACATGCGG - Intronic
1135180704 16:20271811-20271833 AATTTTCTATCCACCCAGTGGGG - Intergenic
1138119215 16:54384779-54384801 TATTTTCTGTCCCCTCCATGAGG + Intergenic
1140567073 16:76055993-76056015 TATTCCATCTCCACACCATGTGG + Intergenic
1141611616 16:85184403-85184425 ATTTCTCTCTCCACATCCTGAGG - Intronic
1146242687 17:31244651-31244673 GATTTTCTTTGCACACCACGGGG + Intronic
1154004736 18:10517426-10517448 AATTTTCCATCCACATCATCAGG - Intergenic
1154402207 18:14051031-14051053 ACCTTTCTCTCCCCACCATGGGG + Intergenic
1155441445 18:25866568-25866590 AGTTTTCTCACCATACCCTGAGG - Intergenic
1156198729 18:34806266-34806288 GATCTTCCCTCCACACAATGTGG - Exonic
1157779520 18:50425117-50425139 AAATTCCTCCCCACTCCATGTGG + Intergenic
1157891481 18:51422337-51422359 ATTTTTGTCTCCAGACCATATGG + Intergenic
1158450927 18:57564197-57564219 AATTTTCTCTCCTTATCATGAGG - Intronic
1159165930 18:64700080-64700102 AATTTTCTCTACGTACCATAAGG + Intergenic
1159446197 18:68544501-68544523 GATTCTCTCTCTGCACCATGTGG - Intergenic
1159802686 18:72920432-72920454 CATTCTCTCTCCACACCACATGG + Intergenic
1163240849 19:16062669-16062691 CTGTTTCTCTCCACACCAAGGGG + Intergenic
1164494601 19:28748432-28748454 AATTATCTCTCCACCATATGTGG + Intergenic
1166017077 19:39990071-39990093 AATTATCTCCTCAGACCATGTGG + Intronic
1167196240 19:48030815-48030837 AATTTTATCTCAACCTCATGAGG - Intronic
925588464 2:5486905-5486927 GATTCTCTCTCCACACAATGTGG - Intergenic
926176652 2:10598952-10598974 AATTTTCCCACCTGACCATGAGG + Intronic
926341227 2:11906353-11906375 AGTTTCCTCTCCACACCTGGAGG - Intergenic
927342604 2:21999195-21999217 AATTTTCTCTCCTCTGCCTGTGG - Intergenic
929019865 2:37541740-37541762 TGTTTTCTCTCGACACCATGTGG + Intergenic
929099874 2:38301540-38301562 GATTGTCTCTCCACACCATGTGG - Intronic
929439809 2:41956486-41956508 GATTTTGGATCCACACCATGTGG - Intergenic
932053117 2:68418749-68418771 ATTTTTCTTTCCCCTCCATGGGG + Intergenic
934257472 2:91439859-91439881 CAGGTTCTCTCCACAGCATGAGG + Intergenic
935459190 2:103308506-103308528 TATTTTCTCTCTACACCCTTCGG - Intergenic
935511861 2:103985662-103985684 TATTATCTCTCAACACAATGAGG - Intergenic
936708198 2:115100909-115100931 ACTTTTCTTTCCACACCAAATGG + Intronic
937108367 2:119340600-119340622 AATTCTCTCACGAAACCATGAGG - Intronic
938955335 2:136292497-136292519 ATTTTCCTCTACACACCCTGAGG + Intergenic
939268601 2:139909156-139909178 CATATTCTCTCCTAACCATGTGG - Intergenic
940248681 2:151648818-151648840 CATTTTCTCTGCATTCCATGGGG - Intronic
941829925 2:169944760-169944782 AATTTTCACTTCACAGCTTGTGG - Intronic
942975871 2:182016210-182016232 GATTCTCTCTCCCCACCATGTGG + Intronic
943485377 2:188473289-188473311 TGTTTTCTCTCAAGACCATGGGG + Intronic
943533412 2:189116183-189116205 CATTCTCTCTCCACTTCATGAGG - Intronic
943844976 2:192634434-192634456 AATTCTCTCTCATCACCATATGG - Intergenic
944373729 2:199015103-199015125 TATCTTCTTTCCATACCATGTGG + Intergenic
944484131 2:200185807-200185829 AATTGTGTCTCTGCACCATGTGG + Intergenic
944760234 2:202807275-202807297 GATTCTCTCTCCACACCATGTGG - Intronic
945771154 2:214044692-214044714 AATTTTCTCTCCATCCCATGTGG - Intronic
948338855 2:237233053-237233075 AAGGATCTCTCCACATCATGAGG + Intergenic
1169541104 20:6600570-6600592 ATGTTTCTCTCCTCCCCATGAGG - Intergenic
1169838473 20:9907235-9907257 AACTTCCTCCCCACATCATGTGG + Intergenic
1170709367 20:18776164-18776186 GATTCTCTCTCCGCACCATGTGG + Intergenic
1171236484 20:23529893-23529915 GATGTTCTCTCCACACTATATGG - Intergenic
1174115930 20:48226297-48226319 AATTTCCTCCCCGCATCATGGGG - Intergenic
1175705117 20:61171046-61171068 TTTTTTTTCTCCAGACCATGTGG - Intergenic
1176914441 21:14608272-14608294 TATTCTCTCTCAGCACCATGAGG - Intronic
1176994853 21:15543622-15543644 GATTCTCTCTCCACACCACGCGG - Intergenic
1178154868 21:29840065-29840087 AATTCCCACTCCACACCATCTGG - Intronic
1180636965 22:17269307-17269329 ATTTTCCTCTCAACACCATCTGG + Intergenic
1181927021 22:26367890-26367912 AATTTTCTCACTTCACCATCTGG - Intronic
1182438747 22:30348687-30348709 AATTTTTTTTCCAAAGCATGAGG - Intronic
1184435592 22:44473130-44473152 AATTTTCTCCCCTAAACATGCGG - Intergenic
1184562868 22:45273529-45273551 ATTTCTCTCTCTCCACCATGCGG - Intergenic
951406411 3:22304751-22304773 AATTCTCTCTTCACACAATCAGG + Intronic
951437103 3:22677225-22677247 GATTCTCTCTCCATGCCATGTGG + Intergenic
951492580 3:23288899-23288921 TATTCTCTCTTCACACCACGTGG + Intronic
952222783 3:31341497-31341519 AATTTCCTTCCCACACAATGAGG + Intergenic
952688491 3:36176280-36176302 GATTCTCTTTCCTCACCATGTGG + Intergenic
955066103 3:55534883-55534905 CATTTCCTCTCAAAACCATGGGG - Intronic
955673858 3:61429600-61429622 AATTTACTCTTCAGACCCTGGGG + Intergenic
956549378 3:70441324-70441346 GATTCTCTCTCCATATCATGTGG - Intergenic
958068330 3:88575095-88575117 ATTTATCTCTCAATACCATGAGG - Intergenic
958617069 3:96508054-96508076 TATTTTCTCTTCACACCAAATGG + Intergenic
962432917 3:135337040-135337062 GATTTTCTTTGCACACCAAGTGG + Intergenic
962637995 3:137350544-137350566 AAATTTATCTCCACATCAGGTGG + Intergenic
963701275 3:148629949-148629971 GATTCTCTCTCCATACCATGTGG - Intergenic
964435484 3:156647295-156647317 AATTTTTACTTCACCCCATGAGG - Intergenic
965145115 3:164890851-164890873 AATTCTCTCTCCACACCATGAGG + Intergenic
965175349 3:165323228-165323250 GATTCTCTCTCCACACCATGTGG + Intergenic
965429204 3:168565931-168565953 AATGGTCTTTCCACAACATGTGG + Intergenic
965995029 3:174871334-174871356 AATTTTCTCTTCATACCCTAAGG - Intronic
966064319 3:175799097-175799119 CATTTTATCTCCATACCTTGAGG - Intronic
966090698 3:176132245-176132267 ACTTTGCTGTCTACACCATGTGG - Intergenic
967578127 3:191121396-191121418 CATTTACTCTTCACAACATGTGG + Intergenic
967772792 3:193353489-193353511 AATGTTCAGTCCACAGCATGGGG - Intronic
969247684 4:5946007-5946029 AACTTACTCTCCACCCCATCAGG + Intronic
970034401 4:11716095-11716117 GATTCTCTCTCCACACCACATGG + Intergenic
970100226 4:12513578-12513600 AATTGTATCTCCACATCTTGAGG + Intergenic
972125406 4:35758968-35758990 GATTTTCTTTCTACTCCATGTGG + Intergenic
972521749 4:39864794-39864816 AATTTTCACTCCATAAGATGAGG + Intronic
974469540 4:62301568-62301590 AATTTTCTCTTTACACCATGTGG - Intergenic
974635272 4:64556219-64556241 AATTGTCTATCCTCACCTTGTGG + Intergenic
974689567 4:65278935-65278957 AATTTTCTCTCCAAAGTATGAGG + Intergenic
975234454 4:71975496-71975518 ACTTTTCTTTCCACACAAAGTGG + Intergenic
976053386 4:81033234-81033256 AATTCTACCTCCAAACCATGTGG - Intronic
976069767 4:81228082-81228104 GTTTTTCTCCCAACACCATGAGG - Intergenic
979534083 4:121799920-121799942 ATTTCTCTCTCCAGACCATGTGG + Intergenic
979994158 4:127410476-127410498 AACTTTGTTTCCACATCATGAGG + Intergenic
980596820 4:134965881-134965903 GATTCTCTCTCTGCACCATGAGG - Intergenic
981394591 4:144233218-144233240 GATTCTCTCTCTGCACCATGAGG - Intergenic
981427547 4:144621135-144621157 AATTTTCTCCTAACTCCATGAGG + Intergenic
981558714 4:146023852-146023874 GATTTCCTCTCCACACCACATGG + Intergenic
981836716 4:149063911-149063933 CAGATTCTCTCCACACCACGTGG - Intergenic
983471255 4:168158484-168158506 AATTTTTTGTCTACACCAAGTGG + Intronic
983867764 4:172789041-172789063 AGTTTTCCCTACACACCAAGTGG + Intronic
983917749 4:173310676-173310698 AATTTTCACAACACACTATGAGG + Intronic
988608646 5:32704194-32704216 GATTCTCTCTCCACACCACATGG + Intronic
989744003 5:44806490-44806512 TGTTTTCTCTCCACCCTATGAGG + Intergenic
990272664 5:54160628-54160650 AATTTTCTCTCCTCACCAACAGG + Intronic
991978826 5:72210810-72210832 CATTTCCCCTCCAAACCATGGGG + Intergenic
993981129 5:94545001-94545023 GATTGTCTTTCCACACTATGTGG - Intronic
994217980 5:97159952-97159974 CATTCTCTTGCCACACCATGTGG + Intronic
995019723 5:107352899-107352921 GATTCTCTCTCCATGCCATGCGG + Intergenic
997644834 5:135474619-135474641 ACTTTTTTTTCCAAACCATGGGG + Intergenic
999967477 5:156824852-156824874 GATTTTCTGTCCAAACCAGGAGG - Intergenic
1000433403 5:161179273-161179295 GATTCTCTCTCCATAGCATGTGG - Intergenic
1004062535 6:12211877-12211899 AAATATTTCTCCATACCATGTGG - Intergenic
1004639165 6:17497509-17497531 AATTTTCTCTCCAAAACGTCTGG + Intronic
1007839639 6:44705165-44705187 ATTTATCTATCCACACTATGAGG - Intergenic
1007943474 6:45804001-45804023 CAGCTTCTCTCCACACCCTGAGG + Intergenic
1008708769 6:54197632-54197654 AATTTTCTTTCCAGCCTATGTGG - Intronic
1008891035 6:56491047-56491069 AGTTTTCTCTCCACATTATGTGG - Intronic
1009039468 6:58159139-58159161 GATTTTGTCTCCATGCCATGTGG + Intergenic
1009215360 6:60913979-60914001 GATTTTGTCTCCATGCCATGTGG + Intergenic
1011117948 6:83915534-83915556 CATTTTCTTTCCACCACATGTGG + Intronic
1011983364 6:93414702-93414724 GATTTCCTCTCCACCCAATGGGG - Exonic
1012570149 6:100714550-100714572 AATTTTCTCTGCAACCTATGAGG - Intronic
1012800348 6:103819627-103819649 GATTTTCTCTTCCCACCACGTGG - Intergenic
1013072727 6:106743626-106743648 TATTTTCTTTCCCCACCATCTGG - Intergenic
1013277212 6:108597040-108597062 AATTTTCTCTCCAGTCCTTTGGG - Intronic
1013702440 6:112789427-112789449 AATTATCTCTCTTCACCAAGAGG + Intergenic
1014234509 6:118939555-118939577 GATTCTCTCTCCACACCATGTGG - Intergenic
1014613403 6:123571604-123571626 AATTTTCTCTCATGAACATGTGG - Intronic
1014855655 6:126397396-126397418 GATTCTCTTTCCACACCATGTGG + Intergenic
1015135809 6:129868803-129868825 AACATTCTCTCCACAGCATCAGG - Intergenic
1015152002 6:130050358-130050380 AATTTTCCCAACACATCATGTGG + Intronic
1015392779 6:132701811-132701833 AATTTTCTCTCCACACCATGTGG - Intronic
1015831155 6:137370327-137370349 AATTTTCCTTTCACACAATGAGG + Intergenic
1018040895 6:159921253-159921275 AGTTTTCTTCCCACAACATGTGG - Intergenic
1018529984 6:164752184-164752206 CATTGTCTCTCAAAACCATGTGG - Intergenic
1018704667 6:166455176-166455198 AGTTTTATCTCCACACGGTGCGG + Intronic
1021144861 7:17073000-17073022 AATTTTCTTTCCATAAAATGGGG - Intergenic
1022854138 7:34298911-34298933 CATTTTCTCTTCAGACCATGAGG - Intergenic
1023655150 7:42412357-42412379 GAATTTCCCTCCAGACCATGAGG - Intergenic
1024054974 7:45654208-45654230 ATTTTTCTGTCCACTTCATGGGG + Intronic
1024111753 7:46154286-46154308 CATTCTCTCCCCACACCATTTGG - Intergenic
1024936043 7:54713165-54713187 AATCATCTCTCCAAACTATGAGG + Intergenic
1025913910 7:65850452-65850474 GATTTTCTCTTCACAGGATGAGG - Intergenic
1026439640 7:70432875-70432897 TGTTTTCTCAGCACACCATGTGG + Intronic
1026660527 7:72298079-72298101 AATGTTCTTTCCACAGCATAAGG + Intronic
1027650180 7:80856912-80856934 AATTTTCATTCCAAATCATGGGG - Intronic
1028059809 7:86298181-86298203 AATTTACCCTCCAAGCCATGAGG - Intergenic
1028160807 7:87483079-87483101 GCTTTTCTCTCCGCACAATGTGG - Intergenic
1028528848 7:91816096-91816118 AAACTTGTCTCCACACCATGTGG + Intronic
1029567735 7:101350108-101350130 AATCCTCTCTCGACACCACGTGG + Intergenic
1030222330 7:107110070-107110092 GATTATCTCTCTGCACCATGCGG - Intronic
1030575282 7:111278286-111278308 AATTTTCTCTATATACCATAGGG - Intronic
1031479452 7:122260547-122260569 CATTGTCTCTCCAAACCATCAGG - Intergenic
1033000407 7:137498024-137498046 CATTTTCTCTCAACTCCCTGAGG - Intronic
1033718058 7:144023740-144023762 TATTGTCTCAGCACACCATGCGG - Intergenic
1039370869 8:36982699-36982721 AATTTTCTACCCACACAATAAGG + Intergenic
1039429694 8:37516138-37516160 AATTTTCTCTCCACGCCACCAGG - Intergenic
1041500343 8:58533199-58533221 AAGTTTCTCCTCAAACCATGGGG + Intergenic
1042898264 8:73694761-73694783 GATTTTCTCTCCACGCCACATGG - Intronic
1043041964 8:75275185-75275207 GATTCTCTCTTCACATCATGTGG - Intergenic
1043393620 8:79815155-79815177 AATCTTCTTTCTACTCCATGGGG - Intergenic
1044383122 8:91557278-91557300 AATTATGTCTCCACATCATAAGG - Intergenic
1046387110 8:113519574-113519596 AATTTTCCCTCCTCACAATGGGG - Intergenic
1047342937 8:124000213-124000235 GATTTTCTTTCCACACCATTTGG + Intronic
1050186301 9:2978269-2978291 AATGTTCTTTCCACAGCATGAGG - Intergenic
1050392471 9:5159841-5159863 ACATTTCTCTCCTCAGCATGCGG + Intronic
1050907017 9:11016930-11016952 GATTTTCTCTCCGCATCACGTGG + Intergenic
1051220618 9:14844559-14844581 ATTATTCTCTTCACACCACGTGG + Intronic
1051781460 9:20692826-20692848 AATTTTCTCTCCCCTTCATCTGG - Intronic
1051888859 9:21923385-21923407 AATTTTCTCTCCTCCCAAAGGGG - Intronic
1051892958 9:21961432-21961454 AAATTTTTCTCCATGCCATGGGG + Intronic
1052409204 9:28101501-28101523 AATTTACTCTTCACACTGTGAGG - Intronic
1052450608 9:28625321-28625343 GATTCTCTCTCCAAGCCATGTGG + Intronic
1052708952 9:32028983-32029005 GATTTTCTCTAAAAACCATGTGG - Intergenic
1053557133 9:39149116-39149138 TATTTTCTCTGCAGAACATGTGG + Intronic
1053821243 9:41969391-41969413 TATTTTCTCTGCAGAACATGTGG + Intronic
1054090120 9:60837544-60837566 TATTTTCTCTGCAGAACATGTGG + Intergenic
1054111531 9:61113101-61113123 TATTTTCTCTGCAGAACATGTGG + Intergenic
1054609326 9:67218024-67218046 TATTTTCTCTGCAGAACATGTGG - Intergenic
1054831877 9:69634195-69634217 GATTCTCTCTCCACACCACATGG - Intronic
1054863239 9:69974362-69974384 ATCTGTCTCTCCACACAATGAGG - Intergenic
1055227258 9:74014528-74014550 GATTCTCTCTCCACACCTTGCGG - Intergenic
1055826907 9:80338472-80338494 GATTCTCTCTCCATGCCATGTGG - Intergenic
1056230700 9:84539765-84539787 GATTCTCTCTCCATGCCATGTGG + Intergenic
1057961987 9:99465735-99465757 AATTTTCTCTCCTCCCCACATGG - Intergenic
1058003826 9:99894976-99894998 GATTCTCTCTCCTCACCACGCGG - Intergenic
1059220596 9:112613806-112613828 AATTTACTTTCCCCACCATGAGG - Intronic
1059886562 9:118751043-118751065 GATTCTCTCTCCATGCCATGTGG - Intergenic
1060378019 9:123135964-123135986 AATTTTCTTTCCTGTCCATGTGG - Intronic
1060478262 9:124000739-124000761 AATTCTCTCTCCCCACAATTTGG + Intergenic
1062063380 9:134511901-134511923 CATTTTCTGTAAACACCATGAGG + Intergenic
1062132994 9:134910239-134910261 AAATCTCTCTCCACAACCTGAGG + Intronic
1062235990 9:135507854-135507876 ATTTTCCTCTCCCCTCCATGGGG + Intergenic
1062693824 9:137861063-137861085 AATTTTCTAACCACAGCCTGAGG - Intronic
1187755144 X:22516862-22516884 GATTTTCTCTCTAGACCCTGTGG + Intergenic
1188421234 X:29992555-29992577 GATTCTCTCTCCATGCCATGAGG + Intergenic
1189854243 X:45208175-45208197 GATTCTCTCTCCACATGATGTGG + Intergenic
1189854526 X:45210248-45210270 GATTCTCTCTCCACATCATGTGG + Intergenic
1191150011 X:57210196-57210218 GATTTTCCCTCCACCCCATAAGG - Intergenic
1191846803 X:65552808-65552830 AATTATCTCTACATACCCTGGGG - Intergenic
1192609292 X:72551940-72551962 AATTTTCTATCCCCACCAATGGG + Intronic
1193191233 X:78573333-78573355 GATTCTCTCTCCATGCCATGAGG + Intergenic
1193802343 X:85951874-85951896 ATTTCTCTTTCCACACCATGTGG - Intronic
1193856832 X:86612641-86612663 GATTCTCTCTCCACACCAGGTGG + Intronic
1194669312 X:96710672-96710694 AATTTTCCCTCCTCATCATATGG - Intronic
1194788599 X:98118178-98118200 GATTCTCTCTCCACACCACATGG - Intergenic
1194819873 X:98492056-98492078 AATTTTCTCCCACCACTATGTGG - Intergenic
1195090239 X:101451407-101451429 AATTTTTTCTCCATGTCATGTGG + Intronic
1195241659 X:102959148-102959170 TATGTTCCCTCCACAGCATGGGG + Intergenic
1197089665 X:122521524-122521546 AATTACCTCCCCACAACATGTGG + Intergenic
1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG + Intergenic
1197922215 X:131607458-131607480 AATTCTCACTCCAAACCATGAGG + Intergenic
1198089679 X:133315420-133315442 AATGGTCTCTCCACACTATTAGG + Intronic
1198611872 X:138410933-138410955 GATTCTCTCTCTACACCACGTGG - Intergenic
1198632105 X:138651835-138651857 AATTTTCCCTCCACCCCATGTGG - Intronic
1198995139 X:142566242-142566264 TATGTTCACTCAACACCATGGGG + Intergenic
1199314815 X:146364147-146364169 GATTTTCTCTCCATGCCACGTGG + Intergenic
1199881275 X:151975400-151975422 AATTTTCTCTGAACCCCAAGGGG + Intergenic
1200816723 Y:7541117-7541139 AATTTTCTCATCACACCAAAAGG - Intergenic