ID: 1015392780

View in Genome Browser
Species Human (GRCh38)
Location 6:132701822-132701844
Sequence GGAGAGAAAATTTGTGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 2, 1: 1, 2: 4, 3: 62, 4: 461}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392768_1015392780 19 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392771_1015392780 6 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392776_1015392780 -1 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392778_1015392780 -4 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392773_1015392780 4 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392774_1015392780 3 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392772_1015392780 5 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461
1015392770_1015392780 13 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG 0: 2
1: 1
2: 4
3: 62
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392780 Original CRISPR GGAGAGAAAATTTGTGCCCT TGG Intronic
900895121 1:5478110-5478132 GGAGAGAAAATTCCTGCTCGAGG + Intergenic
901463721 1:9407229-9407251 GCAGACAAAATTTGAGCTCTGGG - Intergenic
901480418 1:9521115-9521137 AAAAAGAAAATGTGTGCCCTTGG - Intergenic
902962670 1:19975994-19976016 GGAGACAGAATTCTTGCCCTTGG + Intronic
903874776 1:26466245-26466267 GGAGAGAAAAGTTGACCTCTAGG + Intronic
904487726 1:30838612-30838634 AGAGAAAAAATCTGTGCCCTTGG + Intergenic
906615012 1:47228097-47228119 GGAGAGGACATTTGTGGCCAGGG - Intronic
907795168 1:57708757-57708779 GGAGAGAAAATCTGTGCTTAAGG - Intronic
909044349 1:70690928-70690950 GGAGGGAAAAATTGTTTCCTGGG + Intergenic
909065435 1:70930743-70930765 GGTGAGAAAATTTGAACCATGGG - Intronic
910151709 1:84155943-84155965 GGAGAGCAAATTAGTCTCCTTGG - Intronic
910240122 1:85077368-85077390 GGAGAAAATCTTTGTGACCTTGG + Intronic
910470530 1:87547771-87547793 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
910627403 1:89322723-89322745 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
912086221 1:106008678-106008700 GGAGAAAATATTTGTGACTTTGG + Intergenic
916223952 1:162471440-162471462 GGAGAAAAAAGTTGTGGTCTTGG + Intergenic
916296802 1:163228495-163228517 GGAGGGAAAAATGGTGTCCTGGG - Intronic
917191245 1:172421824-172421846 GGAGAGAGAATCTGTGCACTTGG + Intronic
917300683 1:173570858-173570880 AGAGAGAGAATCTGTGCACTTGG - Intronic
917986752 1:180327348-180327370 GGAGAGAGAATCTGTGCACTTGG - Intronic
918492858 1:185100774-185100796 GGACAGTAAATTTGAGCCTTGGG - Exonic
918752689 1:188292513-188292535 AGAGAGAAAAACTGTGCACTTGG + Intergenic
919169697 1:193938526-193938548 GAAGAGAGAATCTGTGCACTTGG + Intergenic
919515029 1:198511727-198511749 AGAGAGAGAATTTGTGTGCTTGG - Intergenic
920733050 1:208506102-208506124 GGAGAAAATGTTTGTGACCTTGG + Intergenic
920762913 1:208803031-208803053 GCAGAGAAAATTTCAGCCCACGG - Intergenic
921164673 1:212498192-212498214 GGAGAGAACAATTGAGCACTAGG + Intergenic
921647911 1:217641060-217641082 CGAAACAAAATTTTTGCCCTAGG - Intronic
921701829 1:218277247-218277269 GGAGAAAACCATTGTGCCCTTGG - Intergenic
922318585 1:224464214-224464236 GGAGAAAAATTTTGTGGCCTTGG - Intronic
922358231 1:224796486-224796508 GGAGGGAGAATTTGTGCAGTTGG - Intergenic
924106281 1:240652648-240652670 GGAGAGAGAATTTGTCCCCCGGG - Intergenic
1063098205 10:2926747-2926769 CAGGAGAGAATTTGTGCCCTAGG - Intergenic
1063323607 10:5075332-5075354 GTAGAGAAAATTTTTTCCCTTGG + Intronic
1063404587 10:5781297-5781319 GGAGAGTATTTCTGTGCCCTTGG + Intronic
1064388139 10:14917311-14917333 GGAGAAAATATTTATGCCTTTGG + Intronic
1065177532 10:23094280-23094302 GGAGAGAATCTTTGTGATCTTGG + Intergenic
1065282844 10:24157563-24157585 GGAGAAAATCTTTGTGACCTTGG - Intronic
1065921710 10:30398933-30398955 TGAGAGAGAATCTGTGCACTTGG + Intergenic
1066755010 10:38702884-38702906 GGAGAAAATATTTATGACCTTGG + Intergenic
1067310376 10:45107465-45107487 CGAAAGAAACTTTTTGCCCTAGG - Intergenic
1067762763 10:49060745-49060767 GGAGAAAATCTTTGTGACCTTGG - Intronic
1070468033 10:76744399-76744421 GGAGATAATTTTTGTGACCTTGG - Intergenic
1070757725 10:79003833-79003855 AGGGAGAAAATTGGTGGCCTTGG + Intergenic
1071196826 10:83170716-83170738 AAAGAAAAATTTTGTGCCCTTGG - Intergenic
1072492507 10:95921343-95921365 GAAGAGAGAATCTGTGCACTTGG - Intronic
1073508186 10:104021705-104021727 GGAGAGAGAAATTGAGACCTAGG + Exonic
1073872307 10:107879629-107879651 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1074395657 10:113095960-113095982 GTAGAGAAGATTTGGGCCTTTGG + Intronic
1075186823 10:120269184-120269206 GGAGAAAATATTTGTGACCTTGG + Intergenic
1075299772 10:121311553-121311575 GTAAAGTAAATTAGTGCCCTGGG - Intergenic
1076376702 10:129993120-129993142 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1077424931 11:2470917-2470939 AAACAGAAAATCTGTGCCCTTGG - Intronic
1077547093 11:3177769-3177791 GGAGAAAATCTTTGTGACCTTGG + Intergenic
1077713200 11:4556232-4556254 GGAGATAACATTTGTCACCTAGG + Intergenic
1078690776 11:13578709-13578731 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1078733631 11:13999822-13999844 GGAGAGAAAGTTTGTGTCCAAGG - Intronic
1079089486 11:17470745-17470767 GGAGACAAAATCAGTGACCTTGG - Intronic
1079868473 11:25764935-25764957 GAAGAGGATATTTGTGACCTAGG - Intergenic
1079952866 11:26826070-26826092 GGAGATAATCTTTGTGACCTGGG - Intergenic
1080227750 11:29978848-29978870 GGAGTGAAAATCAGTGTCCTGGG - Intergenic
1081045656 11:38270012-38270034 GGAGAGAAAAATCGTTCTCTGGG - Intergenic
1081073828 11:38643180-38643202 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1083419174 11:62543885-62543907 GGAGAGAAACTTTGGGGCCTCGG + Intronic
1085551838 11:77380872-77380894 GGAGAGAATTTTTGTGTCTTAGG - Intronic
1085862276 11:80248145-80248167 GGAAAGAAAAATTGTCTCCTGGG - Intergenic
1086738700 11:90340280-90340302 AGAGAGAGAATTAGTGACCTGGG + Intergenic
1087299185 11:96412939-96412961 GGAGAGAGAATATGTACTCTTGG + Intronic
1088268627 11:108010801-108010823 AGAAAGAAAATTTGTGGGCTGGG + Intronic
1088388849 11:109290961-109290983 GGAGAGAAAAATGGTTTCCTGGG - Intergenic
1088609826 11:111566398-111566420 GGAGAGACCATGTGAGCCCTTGG + Intergenic
1088666371 11:112097932-112097954 GAAGAGAAGATTTGTAACCTGGG + Intronic
1088944587 11:114496338-114496360 AGAGGGAAAATCTGTGCACTTGG - Intergenic
1088985077 11:114898781-114898803 GGAGAGAAAATCTGAGAACTTGG + Intergenic
1089016477 11:115169266-115169288 AGAGAGAAAATTGGTGATCTTGG + Exonic
1089554308 11:119307169-119307191 GGAGAGAAGCATTGTACCCTGGG + Exonic
1090577698 11:128125779-128125801 GTAAAGAAACTTTGTGCCCAAGG + Intergenic
1091336070 11:134767255-134767277 GGAGAAAAAATCTGTGTGCTTGG + Intergenic
1091860743 12:3780278-3780300 GGAGAAAAATTTTATGACCTTGG - Intergenic
1093313248 12:17617584-17617606 GGAGGGAAAAATGGTTCCCTGGG - Intergenic
1093798824 12:23346747-23346769 GGAGAGAAAATTAATTCTCTGGG - Intergenic
1093813106 12:23511108-23511130 TGAGTGAAATTTGGTGCCCTGGG - Intergenic
1094611978 12:32003199-32003221 GGAGAAGCAATTTGTGCCTTTGG + Intergenic
1095860135 12:46907776-46907798 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1098395195 12:70010187-70010209 GGAGAGACAATCTGTGCACTTGG + Intergenic
1098922734 12:76317367-76317389 TAAGAGAAAATCTGTGTCCTTGG + Intergenic
1099101018 12:78440120-78440142 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1099233921 12:80059431-80059453 GGAGAGATAATGAGTCCCCTAGG + Intergenic
1099481529 12:83172720-83172742 CTACAGAAAATTTGTGCTCTAGG - Intergenic
1099548558 12:84014308-84014330 GGAGAGAGAATCTGTGCACATGG - Intergenic
1100381107 12:94062771-94062793 AGAGAGAAAATATGTGTGCTTGG + Intergenic
1100596268 12:96074703-96074725 GGAGAGAAAGTGTGTGGACTGGG + Intergenic
1100904802 12:99285730-99285752 GGAGAGAGAATCTGTGTGCTTGG + Intronic
1100909298 12:99339354-99339376 GGAGAGAGAATTTGTGTGTTTGG - Intronic
1105753401 13:23442936-23442958 GCAGTGAACATTTATGCCCTTGG + Intergenic
1106276437 13:28212798-28212820 GCAGAGAAAATGTGAGCCATGGG + Intronic
1106309647 13:28543119-28543141 GGAGGGCAATTTTGTGCCCCGGG + Intergenic
1107177988 13:37422403-37422425 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1107248842 13:38332194-38332216 AGAGAGCATATTTGTGACCTTGG + Intergenic
1108857931 13:54819246-54819268 GGAGAGAGAATCTGTGTACTTGG + Intergenic
1110208672 13:72947369-72947391 GGAGAGAAAAATGGTTTCCTGGG - Intronic
1111085925 13:83374689-83374711 GGAGAGAGAATTTGTGTGCTTGG - Intergenic
1111384291 13:87503563-87503585 TGAGAGAACAAGTGTGCCCTTGG - Intergenic
1112148180 13:96725447-96725469 GGAGAAAATCTTTGTGTCCTTGG - Intronic
1112940312 13:104854118-104854140 AGAGAGAGAATTTGTGCACTTGG + Intergenic
1112944508 13:104910774-104910796 GAAGAGAGAATCTGTGCACTTGG - Intergenic
1113260024 13:108551670-108551692 GGGGTGAAAATTTATCCCCTGGG - Intergenic
1114256969 14:21011363-21011385 GGAGAGTAAATTTTTTCCCCTGG - Intergenic
1114761704 14:25322997-25323019 GCACAGAGAATTTGTGCTCTTGG - Intergenic
1114764936 14:25360236-25360258 GGAGAGAAAAGATGTACTCTGGG + Intergenic
1114921941 14:27343213-27343235 GGAGGGAAAAATTGTTTCCTGGG + Intergenic
1115660880 14:35493581-35493603 GAAGAGAGAATTTGTGTACTTGG + Intergenic
1115695533 14:35894010-35894032 GGAAAGACATTTTGTGCCCATGG - Intronic
1115918239 14:38342009-38342031 AGAGAGAAAAACTGTGCACTTGG + Intergenic
1115932172 14:38509012-38509034 GGAGAGAAAAATGGTTTCCTGGG - Intergenic
1116220994 14:42086474-42086496 GGAGAGCATTTTTGTGCACTGGG - Intergenic
1116496891 14:45571602-45571624 GCAGAGATAACTTGTGCTCTTGG + Intergenic
1116603698 14:46962116-46962138 CCAGAGAAAATTTGTGTCCACGG + Intronic
1117228593 14:53690808-53690830 GGAGAAAAGTTTTGTGCCCTTGG + Intergenic
1117504552 14:56389134-56389156 GGAGAGAAAATCTGTGCACTTGG - Intergenic
1117639673 14:57785295-57785317 GGAGAGAAGTTTGTTGCCCTTGG - Intronic
1118083314 14:62387216-62387238 GGAGAGAAAAATGGTTCCATGGG + Intergenic
1118411367 14:65482076-65482098 GGAGAGAACTTCTATGCCCTTGG - Intronic
1118543427 14:66857833-66857855 GGAGAGAGAATCTGTGCATTTGG + Intronic
1120099999 14:80434448-80434470 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
1120635750 14:86948819-86948841 GGAGAAAAATTTTGTGACCTTGG - Intergenic
1120693817 14:87621810-87621832 GGAGAAAAAAATTGTTTCCTGGG - Intergenic
1121666670 14:95677549-95677571 GGGGAGAAAAGATCTGCCCTTGG + Intergenic
1122042017 14:98994942-98994964 GGAGAAACACTTTGTGACCTTGG + Intergenic
1123046358 14:105518518-105518540 GGAGAAAATCTTTGTGACCTTGG + Intergenic
1126202941 15:46008559-46008581 GGAGCGAAAATATGTGACCTTGG - Intergenic
1126215914 15:46154818-46154840 GGATTGAAAATTTGGCCCCTTGG + Intergenic
1126534033 15:49741582-49741604 AGAGAGAAAATCTGTGTTCTTGG + Intergenic
1127651269 15:61010424-61010446 GTAGTGAAAATTAGTGACCTTGG + Intronic
1127734308 15:61827771-61827793 GGAAAGATAATTGGAGCCCTTGG - Intergenic
1128033493 15:64502357-64502379 GGAGAGAACATTTCTGGACTGGG + Intronic
1128461091 15:67868159-67868181 GGAGAGAAATTTTATGTTCTTGG + Intergenic
1128791455 15:70437609-70437631 GGAGAGAATATTTATACCATGGG + Intergenic
1130034784 15:80348721-80348743 GGAGAATATACTTGTGCCCTAGG - Intronic
1130049851 15:80474746-80474768 GGAGAGAAAATTTCCAGCCTAGG - Intronic
1130203146 15:81851841-81851863 GGAGAGAGACTTTGAGCTCTTGG - Intergenic
1130243374 15:82219686-82219708 GGAAAGAAAATTTTTGTCTTGGG - Exonic
1130349107 15:83074899-83074921 GGACAGAAAATTTGTACCAAGGG - Intergenic
1130457095 15:84121613-84121635 GGAAAGAAAATTTTTGTCTTGGG + Intergenic
1131723786 15:95201298-95201320 GGAGAGAAAAATGGTTTCCTGGG + Intergenic
1131944796 15:97608371-97608393 AGAGAGACAACTTGTGCTCTTGG + Intergenic
1133693886 16:8242330-8242352 GGATAGAAAATTTGTGTCCCAGG + Intergenic
1133834308 16:9352354-9352376 GGAGAGAAGATTTGTGTGTTTGG - Intergenic
1136065946 16:27758645-27758667 GGAGAGCAAATTTGACCCATAGG - Intronic
1136386173 16:29927306-29927328 GGAGTGTAAATGTGTGACCTGGG + Intergenic
1137763961 16:50963277-50963299 GGAGAGAGAATTTTGCCCCTAGG - Intergenic
1138725146 16:59128666-59128688 GGAGAAAGTATTTGTGACCTTGG - Intergenic
1138742371 16:59325625-59325647 GCTGAAAAAGTTTGTGCCCTGGG - Intergenic
1139898028 16:70303916-70303938 GGAGAAAATCTTTGTGGCCTTGG - Intronic
1143620028 17:8075457-8075479 GGAGACCAAATTGCTGCCCTAGG - Intronic
1145054817 17:19694990-19695012 GGAGAAAATCTTTGTGACCTTGG + Intronic
1146970786 17:37070264-37070286 GGAGAAAATTTTTGTGACCTTGG - Intergenic
1148772101 17:50073315-50073337 AAAGAGAAAATTTGAGCCCAGGG - Intronic
1149001493 17:51762345-51762367 GGAGAGATGATTTGTGTCCAGGG + Intronic
1149143128 17:53458002-53458024 GGAGAGAAAAATAGTTTCCTGGG + Intergenic
1149727963 17:58915837-58915859 AGATAGAAAATTTGTGTTCTAGG + Intronic
1152004106 17:77666855-77666877 GGATAGAAACTTTCTGCCCAAGG - Intergenic
1152843412 17:82584910-82584932 GGAATAAAAATGTGTGCCCTGGG + Intronic
1153620382 18:6972043-6972065 AGAGAGAAGTTTTGTGCACTTGG - Intronic
1153739324 18:8106402-8106424 GGTGAGAACATTTGGGCACTTGG + Intronic
1155220581 18:23681978-23682000 GGAGAGAAAATTCATGCAGTTGG + Intergenic
1155830804 18:30513262-30513284 GGAGAGAAGAGCTGTGCCCCTGG - Intergenic
1156142485 18:34132369-34132391 GGAGATACAAATTGTGCCATAGG + Intronic
1156930016 18:42630231-42630253 AGAGAGAAGATTTATGTCCTTGG + Intergenic
1157493835 18:48141541-48141563 GTAGAGAAAATTCGTGAACTGGG + Intronic
1157697700 18:49736323-49736345 GGAGAGAAATTGTCTTCCCTGGG + Intergenic
1157742619 18:50106840-50106862 CGATAGATAATTTGTGCCTTTGG + Intronic
1157879191 18:51304083-51304105 AGAGAGAATATTTGTGTGCTTGG + Intergenic
1158205208 18:54985254-54985276 GGAGAAAAAATGGGAGCCCTTGG - Intergenic
1158466560 18:57695709-57695731 GTCGAGAAAATTTCTGACCTTGG + Intronic
1158468381 18:57712314-57712336 GGAGAGAAAATCTGTACGCTTGG + Intronic
1158563735 18:58536670-58536692 GGAAAGAAACTTGGTGCCCACGG - Exonic
1159138187 18:64361481-64361503 GGAGAGAAAAATGGTTTCCTGGG - Intergenic
1159224915 18:65521920-65521942 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1159756305 18:72370524-72370546 GGAGAGAAAAATGGTTTCCTGGG + Intergenic
1159767717 18:72510013-72510035 GGAGGGAAAAATTGTTTCCTGGG - Intergenic
1159796620 18:72851933-72851955 CTAGAGAAAATGTGTGGCCTGGG - Intronic
1160627224 18:80219028-80219050 GGAGAGAAAAGTGGTTTCCTGGG - Intronic
1160746085 19:711243-711265 GGAGAGAATCTCTGTGCTCTGGG + Intronic
1160769818 19:825618-825640 GGAGACCAGATTTGAGCCCTGGG + Intronic
1163154016 19:15430294-15430316 AGAGGGAAAAGTTGTGCCCAAGG + Intronic
1164387163 19:27782419-27782441 TGAGAGGAAATTAGTGCCCGTGG - Intergenic
1166336721 19:42112668-42112690 GGAGATAAAATACGTCCCCTGGG - Intronic
1166502090 19:43349216-43349238 GGAGAGGAAAACTGAGCCCTGGG - Intergenic
1166508022 19:43384236-43384258 GGAGAGGAAAACTGAGCCCTGGG + Intergenic
1166582204 19:43911338-43911360 GGAGAAAATCTTTGTGACCTTGG + Intergenic
1166757721 19:45203796-45203818 GGAGAGAGAATCTGTGCATTTGG - Intronic
925465435 2:4104184-4104206 GGAGAGTGGATTTGTGTCCTGGG + Intergenic
925994135 2:9278175-9278197 GGAGACAACATTTGTGAACTGGG - Intronic
926535917 2:14112185-14112207 GAAAAGAAAATTTGTAGCCTGGG + Intergenic
926752502 2:16209246-16209268 GGAGAGACAATTGGTACCCCAGG - Intergenic
926842328 2:17095241-17095263 GGAGAAAATATTTGTGAACTTGG - Intergenic
926845226 2:17129563-17129585 GGAGAAACTCTTTGTGCCCTTGG - Intergenic
927446227 2:23164197-23164219 GGACAGAAAATTTTTTCTCTAGG - Intergenic
927849972 2:26492898-26492920 GGAGAGCAGCTCTGTGCCCTTGG + Intronic
928715656 2:34056722-34056744 TGAGACAGAATCTGTGCCCTTGG - Intergenic
929053956 2:37860045-37860067 GGATGGAAATTTTCTGCCCTTGG - Intergenic
929326777 2:40622597-40622619 GGAAAAAATATTTGTGACCTTGG + Intergenic
930727226 2:54694205-54694227 AGAGAGAGAATCTGTGCACTTGG + Intergenic
931107968 2:59078417-59078439 GGAAATATAATTTGTGCTCTCGG - Intergenic
931526029 2:63155203-63155225 GGAGGAAATATTTGTGACCTGGG - Intronic
932858897 2:75267706-75267728 GGAGAGAAAATCCGTGTGCTTGG - Intergenic
933086608 2:78061218-78061240 GGAGAGAGAATCTGTGTCCTGGG + Intergenic
933164444 2:79060554-79060576 GGAGAGCAATTTTGTCCTCTGGG + Intergenic
934318303 2:91947117-91947139 GGAGAAAATATTTATGACCTTGG + Intergenic
935835679 2:107050656-107050678 GGAGAGAAAATCTCTGCACTTGG - Intergenic
937054275 2:118918519-118918541 GGAGAAAATCTTTGTGACCTTGG + Intergenic
937305852 2:120870171-120870193 GGAAAGAAAAGTTCTGTCCTGGG - Intronic
940364211 2:152828220-152828242 CAAGATAAAAATTGTGCCCTTGG + Intergenic
940701020 2:157042714-157042736 GGAGAGAATATTTGAATCCTTGG + Intergenic
940847260 2:158655699-158655721 TGACAGAAAATTTGTGCCAATGG + Intronic
941225933 2:162848432-162848454 GGAGAAAAAATTGGTTTCCTGGG - Intergenic
942908015 2:181206748-181206770 GGAGGGAAAAATGGTTCCCTTGG - Intergenic
943148973 2:184085390-184085412 GGAGAAAATCTTTGTGACCTTGG + Intergenic
943230158 2:185240482-185240504 GGAGAAAAACTTTGTGACCTTGG + Intergenic
943731349 2:191306484-191306506 GGAGAGAGAATATGAGCCTTGGG + Intronic
943867051 2:192938517-192938539 GGAGAAAGAATCTGTGCACTTGG - Intergenic
944373973 2:199018396-199018418 GGAGGGAAAATTTTTCCCTTTGG - Intergenic
944550152 2:200838305-200838327 GGAGAGATAATCTGTGAACTTGG + Intergenic
944772015 2:202924319-202924341 GGAGAAAATCTTTGTACCCTTGG - Intronic
944855211 2:203760540-203760562 AGAGAGAAAATGTGTGTGCTTGG - Intergenic
944874288 2:203945887-203945909 GGAGAGAAAATGTGGGCTCCTGG + Intronic
945843397 2:214914868-214914890 GGAGATAAAATTTGTTGGCTGGG + Intergenic
948475623 2:238217142-238217164 GGAGAGACAATCTGTGCCCTTGG - Intergenic
1169532921 20:6504783-6504805 GGTGAGAAAATTTAGGCCCATGG + Intergenic
1170062645 20:12275828-12275850 GGAGAGAAAATCTGTGTGTTTGG + Intergenic
1170688825 20:18593736-18593758 GGAGAGCAGATTAGTGCCATTGG + Exonic
1170797256 20:19559568-19559590 GGAGAAAATCTTTGTGACCTTGG - Intronic
1170865922 20:20157683-20157705 GGAGAAAATGTTTGTGACCTTGG + Intronic
1171314960 20:24182296-24182318 GGAGAGATCATTACTGCCCTTGG + Intergenic
1171430152 20:25077943-25077965 GGAGAGAAGATCCGAGCCCTGGG - Intronic
1171495897 20:25554967-25554989 CTAGAAAAAATATGTGCCCTGGG + Intronic
1172172677 20:32950098-32950120 GGAGAAAACCTTTGTGACCTTGG + Intronic
1172892271 20:38274603-38274625 GGAGACAAGATCTGGGCCCTGGG - Intronic
1173017807 20:39242372-39242394 GGAGAGAATCTTTGTGACTTTGG + Intergenic
1173709700 20:45143811-45143833 AGAGAGAAAATACGTGCACTGGG - Intergenic
1173867000 20:46318657-46318679 GGAGAGAACATTTGGTCCATGGG - Intergenic
1173899690 20:46578321-46578343 ACAGAGAAAATTTGTCTCCTTGG + Intronic
1173947894 20:46965971-46965993 GGAGAGAAAGCTGGTGCCCATGG + Intronic
1174690926 20:52503787-52503809 GGAGAGAGCATCTGTGCACTTGG + Intergenic
1174754564 20:53145069-53145091 GGAGTGAAAATTTGGGCCTGAGG + Intronic
1177902172 21:26930270-26930292 AGAGAGAAAATGTGTAACCTAGG - Intronic
1180121753 21:45756002-45756024 GGAGATAATCTTTGTGACCTTGG - Intronic
1180191597 21:46167862-46167884 GGAGAGAATCTGTGTGACCTTGG + Intronic
1180241169 21:46507291-46507313 GGAGAAAACATTTGTGACCTTGG - Intronic
1180306483 22:11130800-11130822 GGAGAAAATATTTATGACCTTGG + Intergenic
1180545002 22:16492983-16493005 GGAGAAAATATTTATGACCTTGG + Intergenic
1180711277 22:17841369-17841391 GGACTGAAAATGTGTGCCCCAGG - Intronic
1180712287 22:17847515-17847537 GCAGACAAGATCTGTGCCCTGGG + Intronic
1180798766 22:18621534-18621556 GGAGAGAAAACTGTGGCCCTGGG - Intergenic
1180857682 22:19058720-19058742 GGAGAGGTCATTTGTGTCCTTGG - Intronic
1181222950 22:21373728-21373750 GGAGAGAAAACTGTGGCCCTGGG + Intergenic
1181255792 22:21561892-21561914 GGAGAGAAAACTGTGGCCCTGGG - Intronic
1183573931 22:38675032-38675054 GGTGTGAGAATTTGTGCCGTAGG + Intergenic
1183887065 22:40892856-40892878 GGAGAGAAAATTGGGACACTTGG - Intronic
1184157587 22:42678536-42678558 GGAGAGAAAAATGGTTTCCTGGG + Intergenic
1184204363 22:42991926-42991948 TGAGAAAACATTTGTGACCTGGG + Intronic
949180230 3:1120702-1120724 GGAGAAAATATTTGTGACCTTGG - Intronic
949452329 3:4200052-4200074 AGAGAAAAAATTTGTGACCTTGG - Intronic
949623103 3:5838041-5838063 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
949779305 3:7668186-7668208 GCAGGGAAAGTGTGTGCCCTGGG + Intronic
949959523 3:9300682-9300704 GGGGAGAAATTTTGTCCCCCAGG + Intronic
950639083 3:14336441-14336463 GGGAAAAAAATTTCTGCCCTAGG - Intergenic
951063847 3:18241173-18241195 GGAGAAAAATTTTGTGATCTTGG + Intronic
951272276 3:20640935-20640957 GGGGAGAAAATTTTTACCCATGG + Intergenic
951393081 3:22130637-22130659 GAAGAGAGAATCTGTGCTCTTGG - Intronic
951437102 3:22677214-22677236 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
951495172 3:23317414-23317436 GGAGAGACAATCTGTGCACTTGG - Intronic
951511310 3:23505534-23505556 GGTGATAAAATTTGTGCCTCAGG + Intronic
952056594 3:29454049-29454071 GGAAAAAAAATTTCTTCCCTAGG + Intronic
952198062 3:31096789-31096811 GGAGACAAGATTTATGCCCAAGG + Intergenic
953073790 3:39549486-39549508 GGAGAGAAAAATTGCTCCTTGGG + Intergenic
954111819 3:48437877-48437899 GGAGAGAGGATTTGGGACCTGGG - Intronic
954491485 3:50910735-50910757 GGAGAGACAATCTGTGTACTTGG - Intronic
955185852 3:56714521-56714543 GGAGACAATATTTGTGACCTTGG - Intergenic
955274498 3:57534191-57534213 GGAGAGAGAATCTGTGCACTTGG - Intronic
956762151 3:72453143-72453165 GGAGAAAATCTTTGTGGCCTTGG + Intergenic
956835642 3:73094311-73094333 AGAGAGAAAATGATTGCCCTGGG - Intergenic
957077865 3:75615915-75615937 GGTGAGAAAATTTGAGCTTTAGG - Intergenic
957448590 3:80346581-80346603 GGAGAGAGAATTTGTGTGCATGG - Intergenic
958765993 3:98368361-98368383 GGAGAGACAATCTGTGTGCTTGG - Intergenic
959189962 3:103098210-103098232 GGAGAGAGAATCTGTGCATTTGG - Intergenic
960949471 3:122989790-122989812 TCAGAGAAAATTGGTTCCCTGGG + Intronic
961636919 3:128339010-128339032 GGAGGGAAGAGTTGTGACCTGGG + Intronic
962066968 3:131991767-131991789 GGAGGGAAAAATTGTTTCCTAGG + Intronic
962149787 3:132880656-132880678 GAAGAGCAAAGCTGTGCCCTTGG - Intergenic
963701276 3:148629960-148629982 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
964781448 3:160342896-160342918 GGAAAGATAATTTGGGCCCATGG + Intronic
964992179 3:162827970-162827992 AAAGAGAGAATCTGTGCCCTTGG + Intergenic
965112705 3:164448353-164448375 GGAGAGAAAAATGGTTTCCTGGG + Intergenic
965175347 3:165323217-165323239 GGAGAGAGAATCTGTGGACTTGG - Intergenic
965253050 3:166368015-166368037 AGAGAGAGAATTTGTGCACTTGG + Intergenic
965265063 3:166532182-166532204 GGAGGGAAAAATTGTTTCCTGGG - Intergenic
965379136 3:167966749-167966771 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
965916250 3:173850375-173850397 AGAGAGAGAACTTGTGCCCCAGG - Intronic
965980182 3:174681005-174681027 GGAGAGAGAATCTGTGTGCTTGG + Intronic
966141823 3:176766273-176766295 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
966980082 3:185124600-185124622 GGAGAAAATCTTTGTGACCTTGG + Intronic
968656651 4:1781228-1781250 GGAGAGAGAATTACCGCCCTTGG - Intergenic
968892902 4:3380784-3380806 GGAGGGAAAAATTGTTTCCTGGG - Intronic
969020945 4:4139923-4139945 GGTGAGAAAATTTGAGCTTTAGG - Intergenic
969381867 4:6806064-6806086 GGAGAAAACATTTGGGCCCAAGG - Intronic
969732909 4:8967501-8967523 GGTGAGAAAATTTGAGCTTTAGG + Intergenic
969792489 4:9501580-9501602 GGTGAGAAAATTTGAGCTTTAGG + Intergenic
970229869 4:13898603-13898625 ACAAAGAAAATATGTGCCCTTGG + Intergenic
970661186 4:18287606-18287628 GGAGAGAAAAATGGTTCCATGGG + Intergenic
971483134 4:27131953-27131975 GGAGAGAAAATTTGGACACACGG + Intergenic
971591313 4:28473079-28473101 GGAGAGAAAAATGGTTTCCTTGG + Intergenic
971939755 4:33199758-33199780 GGAGGGAAAAATGGTTCCCTGGG + Intergenic
973327545 4:48878610-48878632 AGAGAGAAAATCTGTGTGCTTGG - Intergenic
973986833 4:56362731-56362753 GGAGAGAAAAGATGAACCCTGGG + Intronic
975089166 4:70380334-70380356 TGAGAGAAAATATGTTCTCTTGG - Intronic
976404165 4:84643238-84643260 GGATATAAAAGTTGTGGCCTAGG - Intronic
976728617 4:88240720-88240742 AGAGAGAGAATCTGTGCACTTGG - Intergenic
977307326 4:95341827-95341849 GGAGAGAGAATCTGTGTCCTTGG + Intronic
977396521 4:96478515-96478537 GGAGGGAAAATTTGTTTCATTGG + Intergenic
977770837 4:100857070-100857092 GGAGAAAATATTTGTGACCATGG - Intronic
977775152 4:100909407-100909429 GGAAAAAAAATCTGTGACCTTGG - Intergenic
977950790 4:102968405-102968427 GGAGAAAATATTTATGACCTTGG + Intronic
978008776 4:103652403-103652425 GGAGAGAGAATCTTTGCCCTTGG - Intronic
978915361 4:114120177-114120199 GGAGAAAACCTTTGTGACCTTGG + Intergenic
978995278 4:115143724-115143746 GCACAGAAAATTTGTGAGCTTGG - Intergenic
979355747 4:119702292-119702314 GGAGAAAATATTTATGACCTTGG + Intergenic
979727237 4:123977045-123977067 GGTGACAACATTTGTGCCCCTGG - Intergenic
980110573 4:128632651-128632673 GCAGAGAAAATGTGTGCTGTTGG + Intergenic
980146075 4:128986146-128986168 GGACAGATAATTTGTGTGCTAGG + Intronic
980263984 4:130492216-130492238 GGAGAGAAAAATGGTTTCCTGGG + Intergenic
981045312 4:140259400-140259422 GAAGAGAAAATATGTGCAGTAGG - Intronic
981406724 4:144379340-144379362 GGAGAGAAAATTCTGTCCCTGGG + Intergenic
981558713 4:146023841-146023863 GGAGAGGAAATCTGTGTGCTTGG - Intergenic
981887732 4:149697499-149697521 GGTGAGAATATTTATACCCTGGG + Intergenic
982339717 4:154284563-154284585 AGAGAGAGAATCTGTGCACTTGG + Intronic
982525003 4:156466996-156467018 GGAGAGAAAATTTGTGCACTCGG + Intergenic
983166072 4:164478388-164478410 AGAGAGAGAATTTGTGTGCTTGG - Intergenic
983996259 4:174186272-174186294 GGAGAGAAGATCTGAGCCCAGGG + Intergenic
985645196 5:1081682-1081704 GGAGAAGAAAGGTGTGCCCTCGG - Exonic
985825350 5:2186930-2186952 AGAGAGAAAGTTGGTGCCATGGG + Intergenic
987057383 5:14207007-14207029 GGAGAGAATCTTTGTGATCTTGG + Intronic
987071467 5:14340847-14340869 GTAGAAAATATTTGTCCCCTAGG - Intronic
987432034 5:17846235-17846257 GGAGAGAAAAAATGAGACCTTGG - Intergenic
988265435 5:28942692-28942714 GGAGAGAAAATCTGTGTCCTTGG - Intergenic
988345700 5:30035533-30035555 GGATGGAAAATTGGTGTCCTGGG + Intergenic
988362674 5:30255733-30255755 GGAGAGAAAAATGGTTTCCTGGG - Intergenic
988628333 5:32900992-32901014 GGAGAGAAAAATGGTTTCCTGGG - Intergenic
989560792 5:42848156-42848178 GGAGAAAATCTTTGTGACCTTGG + Intronic
992155067 5:73946883-73946905 GGACTGAAATTGTGTGCCCTAGG - Intergenic
992540109 5:77756215-77756237 GGAGAGAAAAATTGAGACGTAGG - Intronic
993060163 5:83029462-83029484 TGAGAGAAGATCTGTGCTCTTGG + Intergenic
993171141 5:84420208-84420230 AGAGAGATAATCTGTGCACTTGG - Intergenic
993256974 5:85604445-85604467 GGAGAGAGAATCTGTGTCCTTGG + Intergenic
993269713 5:85779428-85779450 GGAGAGAAAAATGATGCCTTAGG - Intergenic
993335397 5:86651637-86651659 GGAGAAAATATGTGTGGCCTTGG + Intergenic
993697934 5:91084050-91084072 GGAGAGGAAAATGGTGGCCTGGG - Intronic
993886381 5:93420265-93420287 TTAGAGAAAATGTGTGCTCTTGG + Intergenic
993932322 5:93954983-93955005 GGAGAGAGAATCTGTGCATTTGG - Intronic
994003719 5:94812832-94812854 GGAGAAAATATTTGTGGCCTTGG + Intronic
994025899 5:95083063-95083085 TGAAAGAAAATTCCTGCCCTCGG - Intronic
994028469 5:95113449-95113471 GGAGAGAGAATCTGTGCACTTGG + Intronic
994233781 5:97338707-97338729 TGAGAGAAAATCTGTGCCTTTGG + Intergenic
994489060 5:100418448-100418470 GGAAAGAAACTATGTTCCCTTGG - Intergenic
994777461 5:104052182-104052204 GAAGAGAAAATTTGTAACCCTGG - Intergenic
995491293 5:112694281-112694303 GGAGAAAAATTTTGTGACCTTGG + Intergenic
998571801 5:143266616-143266638 GGAGAAAATCTTTGTGACCTTGG - Intergenic
998690219 5:144579966-144579988 ATAGAGAAAAATTGTGACCTTGG + Intergenic
999548077 5:152653357-152653379 GGAGAAAATCTTTGTGACCTTGG - Intergenic
999689632 5:154135482-154135504 AAAGAGAAAATTATTGCCCTGGG - Intronic
1000137394 5:158365959-158365981 GGAGAGCAAATCGGTGGCCTGGG - Intergenic
1000489561 5:161893921-161893943 GAAGATACAATTTGTGCCATAGG - Intronic
1001974849 5:175989546-175989568 GGAGAAAATCTTTGTGACCTTGG + Intronic
1002009879 5:176270643-176270665 GGAGAGAGAATCTGTGTGCTTGG + Intronic
1002209091 5:177585389-177585411 GGAGAGAAATTGTGTGCCGGGGG - Intergenic
1002216847 5:177641665-177641687 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1002242585 5:177854234-177854256 GGAGAAAATCTTTGTGACCTTGG - Intergenic
1003394212 6:5739518-5739540 GGAGAAGGAATTTGTGACCTGGG + Intronic
1003834608 6:10057582-10057604 TGAGAGAAGGCTTGTGCCCTTGG - Intronic
1004869038 6:19884997-19885019 GGAGAAAACCTTTGTGACCTGGG - Intergenic
1005675174 6:28146983-28147005 GGAGAAAATATTTGTAACCTTGG + Intronic
1006075760 6:31531259-31531281 GGAAAGATATTTTGTGTCCTTGG - Intronic
1006417603 6:33913843-33913865 AGAGAGAAAATTTCTGGGCTTGG + Intergenic
1006629095 6:35418630-35418652 GGAGGGAAAAGCTGTGCTCTGGG - Intronic
1006906964 6:37539145-37539167 GGAGAAAAAGTAGGTGCCCTGGG - Intergenic
1006920241 6:37623167-37623189 GGAGAGAAAGGTGGTGCCCCTGG + Intergenic
1008807139 6:55443202-55443224 TTAGAGAAACTTTGTACCCTGGG + Intronic
1009039467 6:58159128-58159150 GGAGACAAAATCTGTGCATTTGG - Intergenic
1009194814 6:60670846-60670868 GGGGAAAATATTTGTGACCTTGG + Intergenic
1009215359 6:60913968-60913990 GGAGACAAAATCTGTGCATTTGG - Intergenic
1009714501 6:67372123-67372145 AGAGAGAATATTTGTGATCTTGG - Intergenic
1009781667 6:68279656-68279678 GGAGAGAAAATCTGTGTGATAGG + Intergenic
1011386406 6:86802746-86802768 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1011579859 6:88849641-88849663 GGAAAGAAAATTTGTGACTCAGG - Intronic
1012047718 6:94300377-94300399 AAAGAGAAAATTTGTGTGCTTGG + Intergenic
1014234510 6:118939566-118939588 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1014378646 6:120711131-120711153 GAAGAGAGAATCTGTGCACTTGG + Intergenic
1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG + Intronic
1015460589 6:133487060-133487082 AGAGAGAGAATCTGTGCACTTGG + Intronic
1016194515 6:141317526-141317548 AGAGAGAGAATCTGTGCCCTTGG + Intergenic
1017131885 6:151114728-151114750 GGAGAGAAAACTCATTCCCTGGG + Intergenic
1017655572 6:156625719-156625741 GGAGAAAAGCTTTGTGACCTGGG - Intergenic
1017970088 6:159304500-159304522 GGAGACATAATTTGAGTCCTTGG + Intergenic
1019066297 6:169302180-169302202 GGAGAGACAATCTGTGTGCTTGG + Intergenic
1020308369 7:6851948-6851970 GGTGAGAAAATTTGAGCTTTAGG - Intergenic
1020800447 7:12726339-12726361 AGAGAGAAAAATCGAGCCCTAGG + Intergenic
1021477618 7:21080423-21080445 GGAAAGCAAATTTGTGCTCTGGG - Intergenic
1021835690 7:24671616-24671638 GGAGTAAAATTTTGTGGCCTTGG - Intronic
1021974015 7:25994174-25994196 GGAGAAAATTTTTGTGACCTTGG + Intergenic
1022093948 7:27126464-27126486 AGATAGAAAATTTGTCCTCTCGG + Intronic
1022583789 7:31585393-31585415 GGATAGTATATTTGTGGCCTTGG - Intronic
1023179578 7:37468708-37468730 GGAGAGAAATTTTGCTGCCTAGG - Intergenic
1024125144 7:46286907-46286929 GGAGAAAATCTTTGTGACCTTGG - Intergenic
1024170174 7:46777291-46777313 GGAGAGAGAATATGTCCACTTGG + Intergenic
1024369230 7:48560349-48560371 GGAGAGGGAATCTGTGCACTTGG - Intronic
1024413799 7:49079174-49079196 GGAGGGAAAAATTGTTTCCTGGG - Intergenic
1024539654 7:50465951-50465973 GGAGAGGAGACTTGAGCCCTTGG - Intronic
1024959979 7:54963887-54963909 TAAGAGAGAATTTGTGCTCTTGG + Intergenic
1027826094 7:83118514-83118536 AGAGAGAGAATTTCTACCCTTGG + Intronic
1028247993 7:88505736-88505758 GGAGAGAAAATCTGTGTATTTGG - Intergenic
1028353525 7:89879040-89879062 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1028653375 7:93174939-93174961 GGAGAGAAAAATGGTTCCCTAGG + Intergenic
1028868186 7:95737118-95737140 GGAGAGAAAATTTGTGCCCTTGG - Intergenic
1028914856 7:96247163-96247185 GGAGAGAAAATGTGTTACCCAGG - Intronic
1030415446 7:109238026-109238048 GGAGGGAAAATTGGTTTCCTGGG + Intergenic
1030966185 7:115995750-115995772 GGAGAGAGTATCTGTGCTCTTGG + Intronic
1031299867 7:120051786-120051808 GAAGAGGAAATTAGTCCCCTAGG + Intergenic
1031306143 7:120130294-120130316 GGAGAGAAAATCTGTGCACTTGG + Intergenic
1031535370 7:122927447-122927469 AGAGTGAAATTTTGTGCTCTAGG + Intergenic
1031608205 7:123794457-123794479 GGAGGGAAAAATTGTTTCCTGGG + Intergenic
1032096860 7:128942616-128942638 GGTTAGAAAAGATGTGCCCTAGG - Intronic
1032942344 7:136809757-136809779 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1033483049 7:141760576-141760598 GGAGAGAAAAATGGTTTCCTGGG - Intronic
1033867905 7:145714717-145714739 AGAGAGACAATCTGTGCTCTTGG - Intergenic
1034005093 7:147463100-147463122 TGAGATGAGATTTGTGCCCTGGG + Intronic
1035138971 7:156738149-156738171 GGAGAGAGAATCTGTGTACTTGG + Intronic
1036431333 8:8693953-8693975 GGAGAAAAAATGTGTGTCATAGG + Intergenic
1036687306 8:10920537-10920559 GCAGAGAAAATGTGTGGACTTGG - Intronic
1036718145 8:11146262-11146284 GGAGAAAATCTTTGTGCCCTTGG + Intronic
1037518465 8:19657159-19657181 GAAGAGACAATTTGTGCACTTGG + Intronic
1038823984 8:30980687-30980709 GGAGAAAATCTTTGTGACCTTGG + Intergenic
1038985665 8:32807062-32807084 GGAGAAAATATTTGTGACCTTGG + Intergenic
1040743243 8:50605569-50605591 GAAGAGAGAATCTGTGCACTTGG - Intronic
1041150026 8:54922474-54922496 GAAGAGAAAATTTCTGAGCTGGG + Intergenic
1041186557 8:55307053-55307075 GGAGAAAATATTTGAGACCTAGG + Intronic
1041525910 8:58805282-58805304 GGAAAGAACATTTGTGGCCATGG + Intergenic
1042162514 8:65911794-65911816 AGAGAGAAAATCTGTGTGCTTGG + Intergenic
1042297819 8:67241881-67241903 AGAGAGAAAATCTGTGTACTTGG + Intronic
1042831245 8:73031242-73031264 GGAGAGAAACATTGTCCCCAGGG + Intronic
1045410083 8:101908405-101908427 GGAGAAAAAATATGTGACTTAGG - Intronic
1045460559 8:102421754-102421776 GGAGTGAATCTTTGTGACCTTGG + Intergenic
1047342936 8:124000202-124000224 GGAAAGAAAATCTGAGCACTTGG - Intronic
1049912837 9:286210-286232 GGAGAGAAAAATTCCGCCTTGGG + Intronic
1050122108 9:2317980-2318002 GGAGAGCATTTCTGTGCCCTGGG - Intergenic
1050540826 9:6668200-6668222 GGACAGTAAATTTGAGCCTTGGG + Intergenic
1050917209 9:11151741-11151763 GGAGAGAAAATTTGCTCCAAAGG - Intergenic
1052093876 9:24361707-24361729 AGAGAGAGAATTTGTGCTCTTGG + Intergenic
1052450607 9:28625310-28625332 GGAGAGAGAATCTGTGCACTTGG - Intronic
1052948876 9:34191770-34191792 GGAAAGATAATTTGCGCCCATGG + Intronic
1053525005 9:38819865-38819887 GGAGTGAAATTTTCTGACCTTGG - Intergenic
1054197236 9:62044280-62044302 GGAGTGAAATTTTCTGACCTTGG - Intergenic
1054641173 9:67544414-67544436 GGAGTGAAATTTTCTGACCTTGG + Intergenic
1054702150 9:68423616-68423638 AGAGAGAGATTTTGTGCTCTTGG - Intronic
1055273606 9:74589380-74589402 GAAGAGAAAATTTGGGTCCATGG - Intronic
1055691798 9:78840017-78840039 CGACAGAAAACTTGTGACCTGGG - Intergenic
1055719594 9:79156751-79156773 GGTGAGAAAGTTTGGGCCCAAGG - Intergenic
1055826908 9:80338483-80338505 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
1056036324 9:82609935-82609957 GGAGAGAAAATGTCTACCTTTGG + Intergenic
1056818551 9:89819583-89819605 GGAGAAAACATTTGTGACCTTGG - Intergenic
1057749427 9:97779794-97779816 GGAGGGAAAAATGGTTCCCTGGG + Intergenic
1057964278 9:99488179-99488201 GGAGGGAAAATTAGTGTGCTGGG - Intergenic
1058086290 9:100752054-100752076 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1058323570 9:103665834-103665856 AGATAGAAAATTTTTGCACTAGG + Intergenic
1058424634 9:104865683-104865705 GGTAAGAAAATTTGTGCTCAGGG - Intronic
1058522970 9:105829828-105829850 AGAGAAAAACTATGTGCCCTTGG - Intergenic
1058927780 9:109684508-109684530 GGATAGAAAAATTCTGCTCTAGG - Intronic
1059158905 9:112015097-112015119 GGAGATAGAAGTTGTGCCCCTGG - Intergenic
1059211650 9:112517506-112517528 GGAGAAAATCTTTGTGACCTTGG + Intronic
1059670824 9:116490659-116490681 GGAGAGAGAATGAGTGCCCAGGG + Intronic
1060450255 9:123731633-123731655 GGAGAAAATCTTTGTGACCTTGG + Intronic
1061011043 9:127954881-127954903 GGAGAGATGCTTTGTGCCCTGGG + Intronic
1186602266 X:11050329-11050351 GGAAAGAGAATCTGTGCACTTGG - Intergenic
1187070152 X:15879792-15879814 GGAGGGAAAATTGGTTTCCTGGG - Intergenic
1187244878 X:17545199-17545221 AGAGATCAAACTTGTGCCCTTGG + Intronic
1188362276 X:29270356-29270378 GGAGAGAATCTTTGTGACTTTGG - Intronic
1188773190 X:34180018-34180040 GTAGGGAAAATGTTTGCCCTCGG + Intergenic
1189628044 X:42920711-42920733 GAAGAGAAAATCTGTGTACTGGG + Intergenic
1189854242 X:45208164-45208186 GGAGAGAGAATCTGTGTCCTTGG - Intergenic
1190046070 X:47112476-47112498 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1190460954 X:50674646-50674668 GGAGAAAAAATTTGGGATCTAGG + Intronic
1190533194 X:51400817-51400839 GGAGTGTAAATTAGTACCCTTGG - Intergenic
1190537128 X:51440562-51440584 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1192197591 X:69039157-69039179 GGAGAACAACTTTGTCCCCTTGG - Intergenic
1192267680 X:69550517-69550539 GGAGAAAACCTTTGTGACCTAGG + Intergenic
1192793297 X:74405709-74405731 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1193191232 X:78573322-78573344 GGAGAGAGAATCTGTGCATTTGG - Intergenic
1193561366 X:83021872-83021894 GGAGAGAGAATCCGTGCACTTGG + Intergenic
1193822074 X:86177568-86177590 CCAGAGAAAATTTGTTTCCTAGG - Intronic
1194032765 X:88836444-88836466 GGAGAGAAAAATTGTCTCCTGGG - Intergenic
1194095640 X:89635998-89636020 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1194110116 X:89823775-89823797 AGAGAGACAATCTGTGCTCTAGG + Intergenic
1194387673 X:93277543-93277565 AGAGAGAAAATCTGTGTGCTTGG + Intergenic
1194788600 X:98118189-98118211 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1194905911 X:99576233-99576255 GGAGGGAAAAATTGTTTCCTGGG + Intergenic
1194929379 X:99867735-99867757 GGAGAGAAAAATAGTTCCCTGGG + Intergenic
1195115630 X:101695677-101695699 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1195872251 X:109498643-109498665 GGAGAGATAATCTGTGCACTTGG - Intergenic
1195919509 X:109968977-109968999 GGAGAAAATATTTGTGACTTTGG - Intergenic
1196001773 X:110794852-110794874 GGAAAGAAAATTGCTACCCTAGG - Intronic
1196588641 X:117460026-117460048 GGAGAGCATTTTTGTGCCCTGGG + Intergenic
1197177955 X:123504754-123504776 GGAGAAAGAATCTGTGCCCTTGG + Intergenic
1197632077 X:128872843-128872865 GGAAATAAAATTTATGCCTTTGG + Intergenic
1198274130 X:135085551-135085573 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1198303659 X:135357216-135357238 GGAGAAAATTTTTGTGACCTTGG - Intronic
1198390424 X:136168584-136168606 GAAGACAAATTTTGTGCCCATGG - Intronic
1198430942 X:136565543-136565565 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1198578398 X:138036350-138036372 GGAGAGAGTATTTGTGCACTTGG + Intergenic
1198663303 X:138995143-138995165 GGAGAGAGAATCTGTGCACTTGG + Intronic
1198770691 X:140126929-140126951 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1198882853 X:141299912-141299934 AGAGAGACAAGTTGTGCACTGGG - Intergenic
1199197375 X:145047460-145047482 GAAGAGAGAATCTGTGCACTTGG + Intergenic
1199254527 X:145703745-145703767 GGAGAGATAGTCTGTGTCCTTGG + Intergenic
1199314814 X:146364136-146364158 GGAGAGAAAATCAGCGCACTTGG - Intergenic
1199357137 X:146875603-146875625 GGAGAGAAAAATTGTTTCCTGGG + Intergenic
1199684005 X:150249617-150249639 GGAGAGAAACTATATGACCTTGG + Intergenic
1200373504 X:155754167-155754189 GGAGTAAATATTTGTGACCTTGG - Intergenic
1200379420 X:155819370-155819392 GAAGAGAGAATTTGTGTGCTTGG + Intergenic
1200448639 Y:3297366-3297388 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1200462775 Y:3478516-3478538 AGAGAGACAATCTGTGCTCTAGG + Intergenic