ID: 1015392781

View in Genome Browser
Species Human (GRCh38)
Location 6:132701823-132701845
Sequence GAGAGAAAATTTGTGCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392774_1015392781 4 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392771_1015392781 7 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392770_1015392781 14 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392778_1015392781 -3 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392772_1015392781 6 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392768_1015392781 20 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392776_1015392781 0 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data
1015392773_1015392781 5 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392781 Original CRISPR GAGAGAAAATTTGTGCCCTT GGG Intronic
No off target data available for this crispr