ID: 1015392783

View in Genome Browser
Species Human (GRCh38)
Location 6:132701825-132701847
Sequence GAGAAAATTTGTGCCCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 2, 1: 0, 2: 5, 3: 53, 4: 291}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392778_1015392783 -1 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392772_1015392783 8 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392774_1015392783 6 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392771_1015392783 9 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392776_1015392783 2 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392773_1015392783 7 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392770_1015392783 16 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392768_1015392783 22 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291
1015392779_1015392783 -9 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG 0: 2
1: 0
2: 5
3: 53
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392783 Original CRISPR GAGAAAATTTGTGCCCTTGG GGG Intronic
902193810 1:14783064-14783086 GAGAAAATTGCTGCCTTTAGGGG + Intronic
904521503 1:31099551-31099573 GAGGAAATCTTGGCCCTTGGGGG - Intergenic
907043818 1:51287183-51287205 GATAAAATTTATGCCCTTAAGGG - Intergenic
907705287 1:56827285-56827307 GAACAAATTTCTGCCCTTGAAGG - Intergenic
908397697 1:63741235-63741257 GAGAGAATCTGTGCACTTGAGGG - Intergenic
909461711 1:75923259-75923281 AAGAAAAATTCTGCCCTTGAGGG - Intronic
910294419 1:85629848-85629870 CAGAAACTTTATGCACTTGGAGG - Intergenic
910320522 1:85938319-85938341 GTGAAAATGTGTTCCCTTTGAGG - Intronic
910627400 1:89322720-89322742 GAGAGAATCTGTGTGCTTGGGGG - Intergenic
910719930 1:90274847-90274869 GAGAAAATTTGTGGAATAGGTGG + Intergenic
910999979 1:93153913-93153935 GAGAAAATGTGTCCCTATGGAGG + Exonic
911011605 1:93287157-93287179 GGGAGAATCTGTGCTCTTGGGGG + Intergenic
911241475 1:95471744-95471766 CAGACAATCTGTGCACTTGGGGG - Intergenic
911747577 1:101456321-101456343 GAGAAAATTAGTGCACTGGATGG + Intergenic
912213022 1:107575692-107575714 GAGAAAAAATGTGGCCTTGAGGG - Intronic
912871401 1:113310457-113310479 GAGAAAATCTGGGTACTTGGGGG + Intergenic
916341946 1:163745967-163745989 AAGAGAATCTGTGCCCTTGAGGG - Intergenic
917191246 1:172421827-172421849 GAGAGAATCTGTGCACTTGGAGG + Intronic
919298959 1:195736738-195736760 AAGGAAATTTGTTACCTTGGTGG - Intergenic
919375207 1:196785844-196785866 GAGGAACTTTGTTCCTTTGGAGG + Intronic
919515026 1:198511724-198511746 GAGAGAATTTGTGTGCTTGGGGG - Intergenic
919867495 1:201793364-201793386 GAGATTATTTGGTCCCTTGGGGG + Intronic
921929506 1:220743579-220743601 GAGAGAGTCTGTGCTCTTGGGGG - Intergenic
922044186 1:221927856-221927878 GAGATAATCTGTGCACTTAGGGG + Intergenic
924281500 1:242442094-242442116 TAGACACTTTGTGCCCTTTGTGG - Intronic
924443326 1:244104691-244104713 GACAAAATTCCTGCCCATGGGGG - Intergenic
1063404590 10:5781300-5781322 GAGTATTTCTGTGCCCTTGGGGG + Intronic
1063823437 10:9864612-9864634 GAGAAAAATTGAGCTCTTGGGGG - Intergenic
1069533320 10:69234766-69234788 GGGAAGGTCTGTGCCCTTGGCGG - Intronic
1072058666 10:91787362-91787384 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
1072492506 10:95921340-95921362 GAGAGAATCTGTGCACTTGGAGG - Intronic
1073827218 10:107337501-107337523 GAGAGAATCTGTGCACTTGGAGG - Intergenic
1073872310 10:107879632-107879654 GAGAGAATCTGTGCACTTGGGGG + Intergenic
1074005599 10:109419894-109419916 GTGAAAATTTGTCCCCTTGAAGG - Intergenic
1075322206 10:121500419-121500441 AAGAAAATTTGTGTTTTTGGAGG - Intronic
1075496256 10:122922142-122922164 AAAAAAATCTGTGCACTTGGTGG + Intergenic
1076376705 10:129993123-129993145 GAGAGAATCTGTGCACTTGGGGG + Intergenic
1077911876 11:6579572-6579594 GAGAGAATCTGTGCACTTGCTGG + Intronic
1078531307 11:12138884-12138906 GGGAACCTTTGTGCCCTGGGTGG + Intronic
1081073827 11:38643177-38643199 GAGAGAATCTGTGCACTTGGTGG - Intergenic
1083347554 11:62004119-62004141 AAGAAAATTTGTACCCTGGCAGG - Intergenic
1083512890 11:63227958-63227980 CAGAGAATCTGTGCACTTGGGGG - Intronic
1083690419 11:64404908-64404930 GAGAAGAGTTGGGCCCTTAGAGG - Intergenic
1086249840 11:84799350-84799372 GAGAGAATCTGTGCACTTGGGGG - Intronic
1087151252 11:94861708-94861730 GTGTAAATGTGTGACCTTGGAGG + Intronic
1088181704 11:107120734-107120756 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
1088776234 11:113086128-113086150 GAGAAAATCTGTTCTGTTGGTGG + Intronic
1090858985 11:130636192-130636214 GAGAAAAATTGCAGCCTTGGAGG - Intergenic
1092561386 12:9617762-9617784 AAGAAAAGTTGTGTCATTGGGGG - Intergenic
1093245792 12:16734614-16734636 GAGAAAAGTTGTGGCATTAGAGG - Intergenic
1093531902 12:20175275-20175297 GAGAAAATCTGTGCAGTTGAGGG - Intergenic
1094527394 12:31240977-31240999 GATAAACTTTGTTACCTTGGCGG + Intergenic
1095181827 12:39154828-39154850 AAGAGAATCTGTGCACTTGGGGG - Intergenic
1096193844 12:49636204-49636226 TAGACATTTTGTGTCCTTGGAGG + Intronic
1097508511 12:60506910-60506932 GAGAAAGTCTGTGCACTTGGGGG + Intergenic
1098046592 12:66407517-66407539 GAGAAAAACTGTGCACTTGTGGG + Intronic
1098395198 12:70010190-70010212 GAGACAATCTGTGCACTTGGGGG + Intergenic
1098503840 12:71226541-71226563 GAAAGAATCTGTGCACTTGGGGG + Intronic
1098736733 12:74113874-74113896 GAGATAATCTGTACACTTGGTGG - Intergenic
1099101015 12:78440117-78440139 GAGAGAATCTGTGTGCTTGGGGG - Intergenic
1100904805 12:99285733-99285755 GAGAGAATCTGTGTGCTTGGGGG + Intronic
1100996733 12:100308919-100308941 GACATAATCTGTGCACTTGGGGG - Intronic
1101607368 12:106257870-106257892 GAGAGAATCTGTGCACTTGAGGG + Intronic
1102018227 12:109662937-109662959 GAGATAATTTGAGACCTTGTTGG + Intergenic
1103600888 12:122053911-122053933 GAGAAAATTTGTACGCATGGAGG + Intronic
1106430305 13:29674720-29674742 GAGAAGATTTATGTCCTGGGTGG + Intergenic
1107177989 13:37422406-37422428 GAGAGAATCTGTGCACTTGGAGG + Intergenic
1107774541 13:43823767-43823789 GAGAGAATCTGTGCACTTGAGGG - Intergenic
1109135887 13:58649986-58650008 GAGAAAAGTAGAGCCCTTGGTGG - Intergenic
1110665878 13:78116793-78116815 GAGAGAATGTGTGCACTTGAGGG - Intergenic
1110919740 13:81069129-81069151 GAGGAAATGTGTTCCTTTGGAGG + Intergenic
1111097088 13:83531121-83531143 GAGAAGATTGCAGCCCTTGGTGG - Intergenic
1112743210 13:102497774-102497796 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
1112940315 13:104854121-104854143 GAGAGAATTTGTGCACTTGGGGG + Intergenic
1112944505 13:104910771-104910793 GAGAGAATCTGTGCACTTGGGGG - Intergenic
1114145647 14:19974032-19974054 GAGAAAATTTGTATTTTTGGGGG + Intergenic
1114985252 14:28218233-28218255 AAGAGAATTTGTGCCTTTGCAGG - Intergenic
1115194132 14:30777972-30777994 GAGCAGATTTGTGGGCTTGGAGG - Intergenic
1115342247 14:32304973-32304995 GAGGAAATGTTTGCCCATGGTGG + Intergenic
1115660883 14:35493584-35493606 GAGAGAATTTGTGTACTTGGGGG + Intergenic
1115918240 14:38342012-38342034 GAGAAAAACTGTGCACTTGGTGG + Intergenic
1116496892 14:45571605-45571627 GAGATAACTTGTGCTCTTGGTGG + Intergenic
1117384372 14:55195832-55195854 GAGAGAATCTGTGCACTTTGGGG - Intergenic
1117870652 14:60197429-60197451 GAGAGAATCTGTGCATTTGGGGG + Intergenic
1118012881 14:61628034-61628056 GGGAACTTTTGTGCCCATGGTGG - Intronic
1118027973 14:61790067-61790089 GAGGATATTTGTGTCCTTGCTGG + Intronic
1118668638 14:68098872-68098894 GAGACAAGTTGTGTCCATGGCGG + Intronic
1119756817 14:77125440-77125462 GAGGGAATTTTTGCCCTCGGCGG + Intronic
1120100002 14:80434451-80434473 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
1120275593 14:82369580-82369602 GAGAGAATCTGTGCACTTGTGGG + Intergenic
1120676271 14:87424268-87424290 GAGAAACTATGTTCCTTTGGAGG - Intergenic
1121723500 14:96129184-96129206 AAGAAAATGTGACCCCTTGGGGG + Intergenic
1122166257 14:99826513-99826535 GATCAAACTTGGGCCCTTGGAGG - Intronic
1124504731 15:30262779-30262801 GATAAATTTTTTGCCTTTGGAGG - Intergenic
1124738821 15:32275856-32275878 GATAAATTTTTTGCCTTTGGAGG + Intergenic
1125277118 15:38004712-38004734 GAGAGAATCTGTGCACTTTGGGG - Intergenic
1125878335 15:43169037-43169059 GAGATAATCTGTGCACTTGTGGG - Intronic
1126765485 15:52007218-52007240 GAGAATATCTCTGCCCTTGGGGG - Intronic
1128656537 15:69466589-69466611 GAGAAAGTTTGTGTCCTCTGGGG + Intergenic
1130400472 15:83547397-83547419 GAGAGAATCTGTGCACTTGCGGG - Intronic
1131635296 15:94226983-94227005 GCGAAAATGTGAGCCATTGGAGG + Intergenic
1131944797 15:97608374-97608396 GAGACAACTTGTGCTCTTGGAGG + Intergenic
1132152768 15:99474342-99474364 GAGGAACGCTGTGCCCTTGGAGG + Intergenic
1136389304 16:29952326-29952348 GAGAGAAACTGTGCACTTGGAGG - Intronic
1139161616 16:64517065-64517087 GAGGAACTCTGTGCCATTGGGGG - Intergenic
1143348870 17:6271984-6272006 GACAGAATTTTTGCCCTTAGGGG + Intergenic
1143466326 17:7139231-7139253 GATAGGATTTGTGCCCTTGTTGG - Intergenic
1148317255 17:46712959-46712981 GAGATCATTTGTGACCTTGATGG + Intronic
1149354399 17:55825054-55825076 AAAAAAATTTGTGCACCTGGTGG - Intronic
1155830801 18:30513259-30513281 GAGAAGAGCTGTGCCCCTGGGGG - Intergenic
1156055484 18:32998149-32998171 GAGATAATCTGTGTGCTTGGAGG + Intronic
1156930017 18:42630234-42630256 GAGAAGATTTATGTCCTTGGTGG + Intergenic
1157493836 18:48141544-48141566 GAGAAAATTCGTGAACTGGGCGG + Intronic
1158184621 18:54757297-54757319 GATAAAATTTGAGCTCTTGAGGG + Intronic
1158205207 18:54985251-54985273 GAAAAAATGGGAGCCCTTGGAGG - Intergenic
1159224916 18:65521923-65521945 GAAAGAATCTGTGCACTTGGAGG + Intergenic
1159775445 18:72598879-72598901 GAAAAAATCTGTGCACTTAGAGG - Intronic
1166895804 19:46021407-46021429 GAGAACATGTGTCCCCTGGGTGG + Intronic
925484841 2:4316549-4316571 GAGAGAATCTGTACACTTGGGGG - Intergenic
926977427 2:18529323-18529345 GAGAAAATCTTGGCCTTTGGAGG - Intergenic
928006199 2:27564218-27564240 AAGAAAATTTGTACTCTAGGTGG - Intronic
928483952 2:31710969-31710991 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
928715653 2:34056719-34056741 GACAGAATCTGTGCCCTTGGGGG - Intergenic
929140457 2:38662328-38662350 GAGGAAATCTGAGCTCTTGGAGG - Intergenic
931736397 2:65198713-65198735 GGGAGACTCTGTGCCCTTGGGGG + Intergenic
934925696 2:98380484-98380506 AAGAAAGTGTTTGCCCTTGGGGG + Intronic
935109131 2:100075836-100075858 GAGATGTTTTGTGCCTTTGGAGG + Intronic
935835676 2:107050653-107050675 GAGAAAATCTCTGCACTTGGGGG - Intergenic
936641546 2:114317378-114317400 AAGACAATCTGTGCCCTTTGGGG - Intergenic
936866245 2:117078046-117078068 GAGAAAATTTGGGCCCATCCTGG - Intergenic
937583116 2:123513362-123513384 GAGAAAGATTATGCCCCTGGGGG + Intergenic
937719577 2:125078257-125078279 GAAAAAAGTTGTGCTATTGGAGG + Intergenic
937739361 2:125332602-125332624 GAGAGAATCTGTGCTCTTGAGGG + Intergenic
939999723 2:148954949-148954971 GGGTTAATTTTTGCCCTTGGAGG + Intronic
941747513 2:169102895-169102917 AAGAACATTTGGGCGCTTGGAGG - Intergenic
941851930 2:170191655-170191677 GAGATAATCTGTGCACTTGCGGG - Intronic
944133383 2:196370851-196370873 GAGAGAATCTGTGCGCTTAGGGG - Intronic
944550155 2:200838308-200838330 GAGATAATCTGTGAACTTGGGGG + Intergenic
944855210 2:203760537-203760559 GAGAAAATGTGTGTGCTTGGAGG - Intergenic
944874291 2:203945890-203945912 GAGAAAATGTGGGCTCCTGGGGG + Intronic
945334320 2:208573468-208573490 GAGAGAATCTGTGTGCTTGGGGG + Intronic
948475622 2:238217139-238217161 GAGACAATCTGTGCCCTTGGAGG - Intergenic
1169157002 20:3340061-3340083 GAGAAGATTTTTGCATTTGGTGG - Intronic
1170709366 20:18776150-18776172 GAGAGAATCTGTGCACTTAGAGG - Intergenic
1172929902 20:38579184-38579206 CAGAAAATTTGAGCCCTAGTAGG + Intergenic
1173947895 20:46965974-46965996 GAGAAAGCTGGTGCCCATGGCGG + Intronic
1174690929 20:52503790-52503812 GAGAGCATCTGTGCACTTGGGGG + Intergenic
1175450202 20:59059181-59059203 TAGAAAATGTGTTCCCTTGCAGG - Intergenic
1175552254 20:59825122-59825144 GACAAAGTCTCTGCCCTTGGAGG + Intronic
1176911454 21:14570093-14570115 GAGAAACTAAGTGCCCTTTGCGG + Intronic
1177137209 21:17318226-17318248 GAAAGAATTTGTGCACTTGGGGG + Intergenic
1177488001 21:21783613-21783635 GAGAGATTTTGTGCCCTGAGAGG - Intergenic
1183806929 22:40219588-40219610 GAGGAAATTGGTGTCCGTGGTGG + Intronic
951393078 3:22130634-22130656 GAGAGAATCTGTGCTCTTGGGGG - Intronic
951403410 3:22263568-22263590 GACAAAACTTTTGCCCTTGTAGG - Intronic
951495169 3:23317411-23317433 GAGACAATCTGTGCACTTGGGGG - Intronic
951763106 3:26165977-26165999 GAAAAAATGTGTGGCCTTGCTGG - Intergenic
952518014 3:34125160-34125182 GAAAGAATCTGTGCACTTGGAGG - Intergenic
953362516 3:42310302-42310324 GAGAGAACCTGTGCCCTTTGGGG - Intergenic
954491482 3:50910732-50910754 GAGACAATCTGTGTACTTGGGGG - Intronic
955004536 3:54956366-54956388 CAGCAAAATTGTCCCCTTGGTGG - Intronic
957448587 3:80346578-80346600 GAGAGAATTTGTGTGCATGGGGG - Intergenic
958052237 3:88363089-88363111 GAGAAAATTTTTGTGCTTGAGGG - Intergenic
958215523 3:90563863-90563885 TGGAAATTTTGTGCCCTTTGAGG - Intergenic
958215604 3:90568900-90568922 TGGAAATTTTGTGCCCTTTGAGG - Intergenic
958765990 3:98368358-98368380 GAGACAATCTGTGTGCTTGGGGG - Intergenic
959126062 3:102291348-102291370 GAGAGAATCTGTGCACTTAGGGG - Intronic
959191066 3:103112376-103112398 GAGAAAATCTGTGCACTTTAAGG + Intergenic
959409155 3:105998422-105998444 GACAGAATCTGTGTCCTTGGGGG - Intergenic
959868579 3:111300375-111300397 GATAGAATTTGTGCACTTAGGGG - Intronic
960709935 3:120518182-120518204 GTCAAAAATTGTGCCTTTGGAGG - Intergenic
960869898 3:122238228-122238250 GAGAAAATCTGTGCATTTTGGGG + Intronic
962031711 3:131607870-131607892 CTTAAATTTTGTGCCCTTGGTGG - Intronic
962767471 3:138579054-138579076 GAGAGAATCTGTGCACTTAGGGG + Intronic
963528855 3:146448008-146448030 GAGAAAATCTGTGTGGTTGGGGG - Intronic
963701279 3:148629963-148629985 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
964151558 3:153531730-153531752 GAGAGAATATGTGCACTTAGGGG + Intergenic
964583012 3:158260889-158260911 GACAGAATCTGTGCACTTGGGGG - Intronic
964992182 3:162827973-162827995 GAGAGAATCTGTGCCCTTGGGGG + Intergenic
965060255 3:163775585-163775607 GAAAAAATCTGTGCACTTGAGGG - Intergenic
965980183 3:174681008-174681030 GAGAGAATCTGTGTGCTTGGAGG + Intronic
966141826 3:176766276-176766298 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
969020944 4:4139920-4139942 GAGAAAATTTGAGCTTTAGGTGG - Intergenic
969792490 4:9501583-9501605 GAGAAAATTTGAGCTTTAGGTGG + Intergenic
969870610 4:10102257-10102279 GAGAAAATTTGGGCCCAGGAAGG + Intronic
972021541 4:34322459-34322481 CAGAGAATCTGTGCCCTTGAGGG + Intergenic
972125403 4:35758954-35758976 AAGAAAATCTGTGCACTTTGGGG - Intergenic
973951731 4:56022360-56022382 GAAACAATTTTTTCCCTTGGAGG - Intronic
974224362 4:59019250-59019272 GAGAGAATCTGTGTGCTTGGGGG - Intergenic
974292179 4:59947455-59947477 GAGAAAATCTGTGCACTTCAAGG + Intergenic
974415085 4:61595982-61596004 GAGAGTATTTGTGCACTTTGGGG - Intronic
975251776 4:72188265-72188287 GAGAAAACTTGTAGCCTTTGGGG - Intergenic
976335898 4:83885827-83885849 GAGAGATTGTGTGTCCTTGGTGG + Intergenic
976912401 4:90323575-90323597 CAGAAAATTTGTGAGCTTGTGGG - Intronic
977307329 4:95341830-95341852 GAGAGAATCTGTGTCCTTGGGGG + Intronic
977376616 4:96213016-96213038 GAGAAAATTTGTGAGTTTGGTGG + Intergenic
977527946 4:98166896-98166918 GAGAGAATCTGTGCTCTTGAGGG - Intergenic
978250318 4:106622996-106623018 GAGAAAATTTTTGCCAGTGATGG - Intergenic
978467441 4:109023498-109023520 GAGAAAATTTATGAGCTTGTTGG + Intronic
978733682 4:112061303-112061325 GAGAGAATCTGTGCATTTGGGGG + Intergenic
978995277 4:115143721-115143743 CAGAAAATTTGTGAGCTTGGTGG - Intergenic
979396621 4:120197186-120197208 GAGAGAATCTGTGCACTTTGGGG + Intergenic
979647839 4:123092924-123092946 CAGGAAATTTGTCCCTTTGGAGG + Intronic
980145652 4:128980892-128980914 GAAAATAATTGTGCCCTTAGAGG + Intronic
980172531 4:129306640-129306662 GAGAGAATCTGTGCACTTTGGGG - Intergenic
980800122 4:137736044-137736066 GAGACAATCTGTGTGCTTGGGGG - Intergenic
981188598 4:141834704-141834726 GAGGAGATTTGTTCCTTTGGAGG - Intergenic
984570335 4:181384175-181384197 GATAAAATTTGTGTCCTAGCAGG - Intergenic
984647612 4:182236151-182236173 CAGGAAATTTTTGCTCTTGGGGG - Intronic
985008022 4:185553861-185553883 GAGAAAATTGGAGCTCATGGAGG + Intergenic
986163528 5:5252334-5252356 GAGAAAATGATTGCCCTGGGGGG + Intronic
986768992 5:10954819-10954841 AAGAAAAGTAGTGCCCATGGTGG - Intergenic
987106601 5:14645880-14645902 GAGAAAATCAGTGCCATTGAGGG - Intergenic
987564179 5:19563895-19563917 GAGAGAATCTGTGCACTTTGGGG + Intronic
987886180 5:23815881-23815903 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
987903772 5:24050005-24050027 GAGAAAATCTGTGCACTTGTGGG + Intronic
988265432 5:28942689-28942711 GAGAAAATCTGTGTCCTTGGGGG - Intergenic
988424863 5:31052146-31052168 TAGAAAATGTGTCCCTTTGGAGG - Intergenic
989657819 5:43762893-43762915 TAGAGAATCTGTGCACTTGGAGG - Intergenic
990237010 5:53779348-53779370 AAGAAAACATGTGCCCTTAGAGG + Intergenic
993060164 5:83029465-83029487 GAGAAGATCTGTGCTCTTGGTGG + Intergenic
993256977 5:85604448-85604470 GAGAGAATCTGTGTCCTTGGGGG + Intergenic
993314296 5:86379993-86380015 GATAAAATTTTTGACCATGGTGG - Intergenic
993932319 5:93954980-93955002 GAGAGAATCTGTGCATTTGGGGG - Intronic
995697911 5:114900412-114900434 GAGAGAATCTGTGTGCTTGGGGG - Intergenic
995731999 5:115255340-115255362 GTGAAAATCACTGCCCTTGGTGG + Intronic
996906694 5:128608995-128609017 GAGAGAATCTGTGTGCTTGGAGG - Intronic
997104507 5:131003901-131003923 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
997177014 5:131789603-131789625 GAGGAAATTGGTGACCTTGATGG - Intronic
998247037 5:140515896-140515918 GAGGAACTTTGTTCCTTTGGAGG - Intronic
998874722 5:146587610-146587632 CAGAAGATTTATGCCCTTAGGGG - Intronic
1000359447 5:160433649-160433671 GAGAAAAGCTGTGTCCGTGGTGG - Intergenic
1000545567 5:162596960-162596982 GAGAAAATCAGTGTGCTTGGGGG + Intergenic
1003071923 6:2951665-2951687 CTCAAAATCTGTGCCCTTGGAGG + Intronic
1003270157 6:4601316-4601338 GAGAAAATTCCTGCCCATAGAGG - Intergenic
1003524183 6:6884720-6884742 TGGAAACTTGGTGCCCTTGGAGG - Intergenic
1005437271 6:25828029-25828051 GATAGAAATTGTGCCCTAGGAGG - Intronic
1007021739 6:38528093-38528115 GAGAGAATCTGTGCACTTGGAGG + Intronic
1008204649 6:48639897-48639919 TAGAAAATTTTTGCACTTGATGG - Intergenic
1008240338 6:49102325-49102347 GAGAAAATCTGTGTGCTTGGGGG + Intergenic
1009687899 6:66987109-66987131 GAGAGAACTTTGGCCCTTGGTGG + Intergenic
1009744731 6:67798275-67798297 GAGAAAATCTGTGCACTTTGAGG + Intergenic
1010309142 6:74362651-74362673 GACAAAAGATGTGACCTTGGAGG + Intergenic
1011627294 6:89293846-89293868 GAGAAACCCTGTGCCCCTGGAGG + Intronic
1012028514 6:94028946-94028968 GAGAGAATCTGTGCACTTGGGGG + Intergenic
1012245384 6:96920360-96920382 GAGAGAATATGTGCCCTAAGAGG + Intergenic
1014667586 6:124258625-124258647 GAGAAAATTAGTGCCCAGAGAGG - Intronic
1015392783 6:132701825-132701847 GAGAAAATTTGTGCCCTTGGGGG + Intronic
1015460592 6:133487063-133487085 GAGAGAATCTGTGCACTTGGGGG + Intronic
1016194518 6:141317529-141317551 GAGAGAATCTGTGCCCTTGGGGG + Intergenic
1016365041 6:143307242-143307264 GAGAAACTGTGTTCCTTTGGAGG + Intronic
1017202512 6:151771309-151771331 TAGAAAAATTGGGCACTTGGAGG + Intronic
1017525786 6:155240448-155240470 GAGACACTTGGTGCCCTTGGGGG + Intronic
1018163977 6:161076400-161076422 CAGAAATTCTGTGACCTTGGGGG + Intronic
1020308368 7:6851945-6851967 GAGAAAATTTGAGCTTTAGGTGG - Intergenic
1020750393 7:12133784-12133806 CAGAAAATTTGTCTCATTGGAGG - Intergenic
1020785689 7:12570464-12570486 GAGAAAATGTCTTTCCTTGGAGG + Intergenic
1020915571 7:14188222-14188244 GAGAAAATTTATTCACTTGATGG - Intronic
1021214744 7:17901632-17901654 GAGAAAATCTGTGCACTTAGGGG - Intronic
1022924956 7:35047402-35047424 GAGTAAATTTGTGACGTGGGTGG + Intergenic
1023209001 7:37782805-37782827 GAGATAATTTGTGTGCTTGCAGG - Intronic
1024369227 7:48560346-48560368 GAGGGAATCTGTGCACTTGGGGG - Intronic
1024767109 7:52672549-52672571 GAGAATAAATGTGCCCTGGGTGG - Intergenic
1025162664 7:56677165-56677187 GAGAAAATGTGTGACTGTGGTGG - Intergenic
1025225428 7:57156198-57156220 GAGAAAATGTGTGACTGTGGCGG - Intergenic
1025267904 7:57481314-57481336 GAGAAAATGTGTGACTGTGGTGG + Intergenic
1025862070 7:65339512-65339534 GAGAGAATTTGTGTGCTTAGGGG - Intergenic
1028868183 7:95737115-95737137 GAGAAAATTTGTGCCCTTGGGGG - Intergenic
1030966188 7:115995753-115995775 GAGAGTATCTGTGCTCTTGGGGG + Intronic
1031098361 7:117448168-117448190 GAGAGAATTTGTGTGCTTTGGGG + Intergenic
1031657733 7:124379429-124379451 GAGATAATCTGTGCACTTTGGGG + Intergenic
1031775578 7:125905070-125905092 AAGATAATCTGTGCACTTGGAGG - Intergenic
1032942347 7:136809760-136809782 GAGAGAATCTGTGCACTTGGGGG + Intergenic
1034435727 7:151062010-151062032 GAAAGAATCTGCGCCCTTGGCGG - Exonic
1035138974 7:156738152-156738174 GAGAGAATCTGTGTACTTGGGGG + Intronic
1039302525 8:36224594-36224616 GTCCAAATTTGTGCCCTTGCTGG - Intergenic
1040743240 8:50605566-50605588 GAGAGAATCTGTGCACTTGGGGG - Intronic
1040745523 8:50636589-50636611 GAGAGAATCTGTGCTCTTTGGGG - Intronic
1041525911 8:58805285-58805307 AAGAACATTTGTGGCCATGGCGG + Intergenic
1041580019 8:59447696-59447718 GAGAGAATCTGTGCACTTTGGGG - Intergenic
1042162517 8:65911797-65911819 GAGAAAATCTGTGTGCTTGGGGG + Intergenic
1042531793 8:69823121-69823143 GAGAAAATGTGATCCTTTGGAGG - Intronic
1042898265 8:73694775-73694797 GAGAAAATCTGTACACTTTGAGG + Intronic
1043041968 8:75275199-75275221 GAGAGAATCTGTGCACCTGGGGG + Intergenic
1043079913 8:75754021-75754043 TTTCAAATTTGTGCCCTTGGTGG - Intergenic
1043955012 8:86349692-86349714 GAGAACATTTGTGGCCTCTGAGG + Intronic
1044124161 8:88437319-88437341 GAGAGAATCTGTGCACTTAGGGG + Intergenic
1046259002 8:111741342-111741364 TGGAAAATTTATGCCCTTTGTGG + Intergenic
1047450529 8:124961399-124961421 GAGAAAATCTGTGGCCAAGGAGG + Intergenic
1047938093 8:129801185-129801207 GAGAGAATCTGTGTGCTTGGAGG - Intergenic
1050248057 9:3712982-3713004 GAGAGAATCTGTGCACTTTGGGG + Intergenic
1050508096 9:6368393-6368415 GAGAGAATCTGTGCACTTGAGGG + Intergenic
1050907016 9:11016916-11016938 GAGAAAATCTGTGTGCTTGCAGG - Intergenic
1051006534 9:12352261-12352283 GAGCAAAATTGTCCCCTGGGAGG - Intergenic
1051469708 9:17423831-17423853 GAGAGAATCTGTGTGCTTGGGGG - Intronic
1051856401 9:21572077-21572099 GAGAAAATGAATGCCCTTAGGGG + Intergenic
1052205022 9:25828540-25828562 GAGAGAATCTGTGCACTTTGGGG - Intergenic
1052472575 9:28918304-28918326 GAGATAATTTGAACCCTGGGGGG - Intergenic
1052507584 9:29375863-29375885 GAGAAAATTCATGCCTTCGGGGG - Intergenic
1052897039 9:33757378-33757400 GACAGAATTTCTGCCCTTGAAGG + Intronic
1055910959 9:81350626-81350648 GAGAGAATCTGTGCACTTTGGGG + Intergenic
1057957486 9:99423268-99423290 GGGATGATTTGTGCCCTGGGTGG - Intergenic
1058031833 9:100208538-100208560 GCGAAGATGTGTGCCTTTGGGGG - Intronic
1058086289 9:100752051-100752073 GAGAGAATCTGTGCACTTGGAGG - Intergenic
1058424633 9:104865680-104865702 AAGAAAATTTGTGCTCAGGGAGG - Intronic
1059091108 9:111359321-111359343 GAAAAAAGATGTGCCCTTGTTGG - Intergenic
1059110485 9:111554647-111554669 GGGATAATTTGTGTCCTAGGAGG + Intronic
1203357577 Un_KI270442v1:173679-173701 GTGGAAATTTGAGCCCTTTGTGG + Intergenic
1186602263 X:11050326-11050348 AAGAGAATCTGTGCACTTGGGGG - Intergenic
1187836115 X:23434216-23434238 GAGAGAATCTGTGCACTTGCAGG + Intergenic
1188734607 X:33696844-33696866 GAAAGAATTAGGGCCCTTGGTGG + Intergenic
1188974546 X:36657478-36657500 AAAAAAATCTGTGCACTTGGTGG - Intergenic
1189059364 X:37736595-37736617 GAGGAAATGTGTGACCCTGGCGG - Intronic
1189628047 X:42920714-42920736 GAGAAAATCTGTGTACTGGGGGG + Intergenic
1189854239 X:45208161-45208183 GAGAGAATCTGTGTCCTTGGGGG - Intergenic
1190046073 X:47112479-47112501 GAGAGAATCTGTGCACTTGGGGG + Intergenic
1190537129 X:51440565-51440587 GAGAGAATCTGTGCACTTGGAGG + Intergenic
1191892688 X:65960995-65961017 GAGTAAATTTGTACCCTTTGGGG - Intergenic
1192526993 X:71855475-71855497 GAGAAAATTTTTGCACATGATGG - Intergenic
1192599027 X:72441635-72441657 GAGAAACTGTGTTCCTTTGGAGG - Intronic
1193052508 X:77116090-77116112 GAGAGAATCTGTGTACTTGGGGG - Intergenic
1193191229 X:78573319-78573341 GAGAGAATCTGTGCATTTGGGGG - Intergenic
1193194952 X:78620407-78620429 AAGAAAATCTGTGTGCTTGGGGG - Intergenic
1193366832 X:80644378-80644400 GAGAGAATCTATGCACTTGGGGG - Intergenic
1193742237 X:85231610-85231632 GAGAGAACTTGTGTGCTTGGGGG + Intergenic
1194095643 X:89636001-89636023 GAAAGAATCTGTGCACTTGGGGG + Intergenic
1194257616 X:91653516-91653538 GAGAGAATCTGTGCACTTGTGGG - Intergenic
1194316199 X:92380031-92380053 GAGAAGAGCTGTGCCCTTTGGGG + Intronic
1194327796 X:92541375-92541397 CAGAGAGTTTGTGCACTTGGGGG - Intronic
1194387676 X:93277546-93277568 GAGAAAATCTGTGTGCTTGGGGG + Intergenic
1194684241 X:96892788-96892810 GAGAAAATGTATTGCCTTGGTGG - Intronic
1195823202 X:108969746-108969768 GAGAGAATCTGTGCACTTGAAGG + Intergenic
1196234602 X:113263348-113263370 GAGAAAATCTGTGTGCTTGAGGG - Intergenic
1197099680 X:122637430-122637452 GAGAGAATCTGTGCACTTAGAGG - Intergenic
1197177958 X:123504757-123504779 GAAAGAATCTGTGCCCTTGGGGG + Intergenic
1197399867 X:125977333-125977355 GAGAGAATCTGTGTGCTTGGGGG + Intergenic
1198274127 X:135085548-135085570 GAGAGAATCTGTGCACTTGGGGG - Intergenic
1198770688 X:140126926-140126948 GAGAGAATCTGTGCACTTGGGGG - Intergenic
1199306467 X:146272709-146272731 GAGAGAATTTGTGTACTTAGGGG - Intergenic
1199921126 X:152405143-152405165 GAGAGAATCTGTGTGCTTGGAGG + Intronic
1200448642 Y:3297369-3297391 GAAAGAATCTGTGCACTTGGGGG + Intergenic
1200576274 Y:4892462-4892484 GAGAGAATCTGTGCACTTGTGGG - Intergenic
1200624243 Y:5491604-5491626 GAGAAGAGCTGTGCCCTTTGGGG + Intronic
1200636510 Y:5660593-5660615 CAGAGAGTTTGTGCACTTGGGGG - Intronic
1201790459 Y:17834479-17834501 GATAAATTTTGGGCCCATGGAGG + Intergenic
1201811095 Y:18071510-18071532 GATAAATTTTGGGCCCATGGAGG - Intergenic
1201934605 Y:19394883-19394905 GAAAAAATTTCTGGCCTTGCTGG - Intergenic
1202352108 Y:24004223-24004245 GATAAATTTTGGGCCCATGGAGG + Intergenic
1202357291 Y:24064773-24064795 GAGAAGCTGTGTTCCCTTGGAGG - Intergenic
1202513486 Y:25605341-25605363 GAGAAGCTGTGTTCCCTTGGAGG + Intergenic
1202518671 Y:25665896-25665918 GATAAATTTTGGGCCCATGGAGG - Intergenic