ID: 1015392784

View in Genome Browser
Species Human (GRCh38)
Location 6:132701829-132701851
Sequence AAATTTGTGCCCTTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 2, 1: 0, 2: 4, 3: 65, 4: 371}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392779_1015392784 -5 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392770_1015392784 20 Left 1015392770 6:132701786-132701808 CCACTCTCCCCCATCCTCCAGGT 0: 1
1: 0
2: 11
3: 103
4: 783
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392772_1015392784 12 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392778_1015392784 3 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392774_1015392784 10 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392773_1015392784 11 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392776_1015392784 6 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392771_1015392784 13 Left 1015392771 6:132701793-132701815 CCCCCATCCTCCAGGTTACCACA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371
1015392768_1015392784 26 Left 1015392768 6:132701780-132701802 CCAATACCACTCTCCCCCATCCT 0: 1
1: 0
2: 4
3: 43
4: 379
Right 1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG 0: 2
1: 0
2: 4
3: 65
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392784 Original CRISPR AAATTTGTGCCCTTGGGGGA AGG Intronic
902651010 1:17837614-17837636 ATCTCTGTGCCCTTGGGGGAGGG + Intergenic
903128342 1:21262601-21262623 ATCTTTGTGGCCTTGGGGGAGGG - Intronic
903711148 1:25325544-25325566 AGATGGGTGCCCTTGGGGGGTGG - Intronic
903715800 1:25365885-25365907 AGATGGGTGCCCTTGGGGGGTGG + Intronic
903803007 1:25983921-25983943 AAGTTTGTGCCAGTTGGGGAGGG - Intronic
904355436 1:29935970-29935992 AAATTCTAGCCCTTGGGGGAAGG - Intergenic
905028067 1:34865021-34865043 AACATTGTGCCCCTAGGGGAAGG + Intergenic
905523073 1:38615061-38615083 AAGCCTGAGCCCTTGGGGGAAGG + Intergenic
906290735 1:44617818-44617840 AAAGATGTGCCTTTGGTGGATGG - Intronic
908397695 1:63741231-63741253 GAATCTGTGCACTTGAGGGAGGG - Intergenic
908517523 1:64908518-64908540 AAATTAGTGCTTTTGGGAGAAGG + Intronic
909438517 1:75672275-75672297 AAATCTGTGTACTTTGGGGAGGG + Intergenic
909582460 1:77253448-77253470 AAATCTATGTGCTTGGGGGAGGG + Intergenic
909847520 1:80414407-80414429 CAATTTTTGCCCTATGGGGATGG - Intergenic
909902974 1:81160899-81160921 GAATCTGTGCACCTGGGGGAAGG + Intergenic
910289654 1:85588029-85588051 GAATCTGTGCTCTTGGGAGAGGG + Intergenic
910379456 1:86610073-86610095 AAATTGGTGTCCTTGTGGCAGGG + Intergenic
910627398 1:89322716-89322738 GAATCTGTGTGCTTGGGGGAGGG - Intergenic
910732992 1:90419895-90419917 AAATTGGTGTCCTTGAAGGAGGG - Intergenic
911241473 1:95471740-95471762 CAATCTGTGCACTTGGGGGAGGG - Intergenic
912513581 1:110204367-110204389 AAGTTTGGGCCCTGGGTGGAGGG + Intergenic
912871403 1:113310461-113310483 AAATCTGGGTACTTGGGGGAGGG + Intergenic
916341944 1:163745963-163745985 GAATCTGTGCCCTTGAGGGAGGG - Intergenic
917300679 1:173570851-173570873 GAATCTGTGCACTTGGGGAAGGG - Intronic
917750524 1:178049279-178049301 TAATTTGTTCCCTTTGGGGGAGG - Intergenic
918357890 1:183723486-183723508 GAATCTGTGCTCTTGCGGGAGGG + Intronic
918613644 1:186519820-186519842 AAGTTGATGCCCTTGGGGGTTGG - Intergenic
918752692 1:188292520-188292542 AAAACTGTGCACTTGGGAGAGGG + Intergenic
919737882 1:200964946-200964968 AGATTTTTGCCCTCAGGGGATGG + Intergenic
1064221468 10:13444438-13444460 AAAGTTGTGTATTTGGGGGAAGG - Intronic
1064521790 10:16210314-16210336 GAATCTGTGCTCTTGGGAGAGGG - Intergenic
1065921714 10:30398940-30398962 GAATCTGTGCACTTGGGGAAGGG + Intergenic
1066143109 10:32527233-32527255 GAATCTGTGCACTTTGGGGAGGG - Intronic
1066299716 10:34086031-34086053 AAATTTGTACAATTAGGGGATGG + Intergenic
1066758740 10:38736061-38736083 CTATTTGTGGCATTGGGGGACGG + Intergenic
1067247272 10:44557454-44557476 ACATGTGGGCCCTTTGGGGAGGG + Intergenic
1068203304 10:53812905-53812927 ATATTTGTGCCCTCAGAGGAGGG - Intronic
1068637120 10:59360236-59360258 AAGTTTGTGCCCTTGGGAAGTGG - Intronic
1069193572 10:65520321-65520343 GAATCTGTGCACTTGAGGGAGGG - Intergenic
1069302530 10:66926443-66926465 AAATTGGACCCCTTGGGAGATGG - Exonic
1070059561 10:72968694-72968716 AAATCTATGACCTTGGGAGAGGG - Intergenic
1072492504 10:95921336-95921358 GAATCTGTGCACTTGGAGGAGGG - Intronic
1072695602 10:97600698-97600720 AGATTTGAGCCCTGGAGGGAAGG + Intronic
1072916252 10:99538972-99538994 AATTTTGTGCCCTGGGGTCAAGG - Intergenic
1073119769 10:101114417-101114439 AAATGTCAGCCCTGGGGGGAGGG - Intronic
1073827216 10:107337497-107337519 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1073872312 10:107879636-107879658 GAATCTGTGCACTTGGGGGAGGG + Intergenic
1074038311 10:109762771-109762793 TAATCTGTGCTCTTGGGAGAGGG - Intergenic
1074038333 10:109762968-109762990 AAATTGGTGTCCTTGGAGGCGGG + Intergenic
1074504191 10:114053512-114053534 AAACATGTGCCCTTTCGGGAGGG - Intergenic
1075496258 10:122922146-122922168 AAATCTGTGCACTTGGTGGGAGG + Intergenic
1075823317 10:125332527-125332549 AATCTTGTGCCTATGGGGGATGG + Intergenic
1076376706 10:129993127-129993149 GAATCTGTGCACTTGGGGGAAGG + Intergenic
1076731829 10:132443005-132443027 AAATTTGAGTCCTTAGAGGACGG - Intergenic
1077424929 11:2470910-2470932 AAATCTGTGCCCTTGGTTTAGGG - Intronic
1077709528 11:4522324-4522346 AAATTGGTGTCCTTGTGGTAGGG - Intergenic
1078690779 11:13578716-13578738 GAATCTGTGCACTTGGGTGAGGG + Intergenic
1078843196 11:15097745-15097767 GAATCTGTGCTCTTGGGAGAGGG - Intergenic
1078936606 11:15956862-15956884 AAAGTTGTGCCCTCGAGGGCTGG - Intergenic
1081073826 11:38643173-38643195 GAATCTGTGCACTTGGTGGAAGG - Intergenic
1086664009 11:89457288-89457310 ACATTTGTGCTGTTGGTGGAAGG - Intronic
1086759678 11:90612332-90612354 TTATTGGTGACCTTGGGGGAGGG - Intergenic
1088662630 11:112062956-112062978 AAATTAATTCTCTTGGGGGAAGG + Exonic
1090101768 11:123805188-123805210 AAATGTGTGCCATTGGGGGAGGG + Intergenic
1090111100 11:123910468-123910490 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1091741174 12:2961056-2961078 AGATCTTTGCCTTTGGGGGATGG + Intronic
1091885259 12:4012540-4012562 AGCTCTGTGCCCTTAGGGGAGGG - Intergenic
1092644512 12:10554964-10554986 AGTTCTCTGCCCTTGGGGGAGGG - Intergenic
1093694384 12:22143708-22143730 GAATCTGTGCACTTGAGGGAGGG + Intronic
1095181825 12:39154824-39154846 GAATCTGTGCACTTGGGGGAGGG - Intergenic
1095860139 12:46907783-46907805 GAATCTGTGCACTTGGGGAAGGG + Intergenic
1097296941 12:57975841-57975863 TCATTTGTGCCCTTGGGAGAAGG - Intergenic
1097757394 12:63421984-63422006 AGATGTGTGCCAGTGGGGGAAGG - Intergenic
1098046594 12:66407521-66407543 AAAACTGTGCACTTGTGGGAGGG + Intronic
1098395200 12:70010194-70010216 CAATCTGTGCACTTGGGGGAGGG + Intergenic
1098503842 12:71226545-71226567 GAATCTGTGCACTTGGGGGAGGG + Intronic
1099101013 12:78440113-78440135 GAATCTGTGTGCTTGGGGGAGGG - Intergenic
1099757787 12:86876910-86876932 AAATCTGTGTGCTTGGAGGAGGG - Intergenic
1100866212 12:98859806-98859828 AAATTTTTGGCCTTTTGGGAGGG + Intronic
1101226521 12:102693511-102693533 AAATTGGTGTCCTTGTTGGAGGG - Intergenic
1101607370 12:106257874-106257896 GAATCTGTGCACTTGAGGGAGGG + Intronic
1103792689 12:123482896-123482918 AAAATGGTGCCCTTGGGGCTGGG - Intronic
1105282467 13:18975848-18975870 ACATTTGTCCTCTTGGGAGAGGG - Intergenic
1106350098 13:28921854-28921876 AAATCCGTGCACTTGGGAGAGGG - Intronic
1106451285 13:29885131-29885153 AAATATGAGCCTTTTGGGGAAGG - Intergenic
1106984733 13:35332915-35332937 AAATTAGTGCCCCAAGGGGAAGG + Intronic
1107210754 13:37851810-37851832 AAGTCTGTGCACTTGGAGGAGGG + Intronic
1107303134 13:38987082-38987104 AAAATTGGACCCTTGGGGAAAGG + Intronic
1107774539 13:43823763-43823785 GAATCTGTGCACTTGAGGGAGGG - Intergenic
1110376598 13:74801765-74801787 AAATTTGTGCCCTTGCAGGAGGG - Intergenic
1110376620 13:74801968-74801990 AAATGTGTGCTCTTGGGAGAGGG + Intergenic
1110619259 13:77577318-77577340 AAATTTATGACCATGGAGGAAGG + Intronic
1110665876 13:78116789-78116811 GAATGTGTGCACTTGAGGGAGGG - Intergenic
1111300469 13:86342616-86342638 GAATCTGTGCCCTTGGTTGAGGG - Intergenic
1111639191 13:90946606-90946628 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1112879140 13:104084679-104084701 AACTTTGGGGACTTGGGGGAAGG - Intergenic
1112944503 13:104910767-104910789 GAATCTGTGCACTTGGGGGAGGG - Intergenic
1113785159 13:112998598-112998620 AAATGTGTGTCCCTGGGGAACGG + Intronic
1114968829 14:28000862-28000884 AAATCTGTGCTCTTGGGAGGGGG + Intergenic
1114985251 14:28218229-28218251 GAATTTGTGCCTTTGCAGGAAGG - Intergenic
1115700986 14:35952824-35952846 AAGTTTGGGCCACTGGGGGAGGG + Intergenic
1116257010 14:42570154-42570176 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1116489963 14:45493547-45493569 AAATTGGTGTCCTTGCAGGAGGG + Intergenic
1117384370 14:55195828-55195850 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1117812578 14:59564549-59564571 AAATTTGTGAGGGTGGGGGAGGG - Intronic
1117870654 14:60197433-60197455 GAATCTGTGCATTTGGGGGAGGG + Intergenic
1118034284 14:61849642-61849664 GAATCTGTGCACTTGAGGGAGGG - Intergenic
1118431288 14:65720968-65720990 GAATCTGTGTGCTTGGGGGAGGG - Intronic
1120100004 14:80434455-80434477 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1120275595 14:82369584-82369606 GAATCTGTGCACTTGTGGGAGGG + Intergenic
1123204759 14:106701531-106701553 TAATTTGTGCCAAGGGGGGATGG + Intergenic
1125277116 15:38004708-38004730 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1126304467 15:47239399-47239421 AAAATTGTGGGATTGGGGGATGG - Intronic
1127971649 15:63966752-63966774 GAACCTGTGCACTTGGGGGAGGG - Intronic
1128218257 15:65949405-65949427 AAATTTGTTCATTTGGGTGATGG + Intronic
1129030754 15:72616036-72616058 GAATCTGTGCACCTGGGGGAGGG - Intergenic
1129391891 15:75224878-75224900 AACTTTGTGCACCTTGGGGATGG + Intergenic
1129477597 15:75796560-75796582 GAATCTGTGCACCTGGGGGAGGG - Intergenic
1129835664 15:78703837-78703859 GAATCTGTGCACCTGGGGGAGGG - Intronic
1130511672 15:84594799-84594821 GAATCTGTGCACTTGGGAGAGGG + Intergenic
1131033254 15:89204069-89204091 AATTTTATCCCCTTTGGGGAGGG - Intergenic
1131944798 15:97608378-97608400 CAACTTGTGCTCTTGGAGGAAGG + Intergenic
1132834590 16:1946479-1946501 AATCTTGAGCCCTTGGGGCAGGG + Intronic
1133407624 16:5538078-5538100 AACTTTGTGCCTTTGGGGTCAGG - Intergenic
1133851677 16:9510474-9510496 AAATTTGTGCCCTTAGAGAGAGG + Intergenic
1135187241 16:20325892-20325914 AAATTTCAGCCCCTGGAGGAGGG - Intronic
1136110308 16:28060447-28060469 AAAATTGTGATTTTGGGGGAGGG + Intronic
1138638451 16:58362817-58362839 AAATTGATGTCCTTGTGGGAAGG + Intronic
1138984841 16:62315773-62315795 AAATTTGTGACCTTGAGATATGG + Intergenic
1141512354 16:84520802-84520824 AGAATTGTGCCCTTGGGAGGCGG - Intronic
1142222007 16:88860093-88860115 AAACCTCTGCCCTAGGGGGATGG - Intronic
1143756861 17:9073655-9073677 AAATGTTTGCCCTGGAGGGAAGG - Intronic
1145069082 17:19787891-19787913 TAATCTGTGTACTTGGGGGAGGG + Intronic
1145949602 17:28805844-28805866 AAAAATGTGCCCTTGAGGCAGGG + Intronic
1146749812 17:35368313-35368335 AAATCTGTGTGCTTGGGGAAGGG + Intronic
1148073188 17:44920672-44920694 AAGTAACTGCCCTTGGGGGAGGG - Intergenic
1150550244 17:66203431-66203453 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1151698567 17:75730672-75730694 AAATGTGGGCCCTAGTGGGAAGG + Intronic
1153183421 18:2460753-2460775 AAAATTGTGTGCTTGGGGGAGGG - Intergenic
1153979869 18:10299657-10299679 GAATTTGAGTCCTTGGGGAATGG + Intergenic
1155767347 18:29652350-29652372 GAATCTGTGCATTTGGGGGAGGG + Intergenic
1156467108 18:37354602-37354624 AAATTGGAGCCCTTTGGGGTTGG + Intronic
1156912491 18:42426871-42426893 GAATCTGTTCACTTGGGGGAAGG - Intergenic
1157879194 18:51304090-51304112 ATATTTGTGTGCTTGGGAGAGGG + Intergenic
1158468384 18:57712321-57712343 AAATCTGTACGCTTGGGAGAGGG + Intronic
1159529083 18:69632538-69632560 AAATTTGTACCCGTGTGGGGAGG - Intronic
1159569601 18:70096902-70096924 AAATTTTTGACCTTGGGGAAGGG - Intronic
1162089294 19:8268404-8268426 AAATTGGTGTCCTTGTTGGAGGG - Intronic
1162844949 19:13385193-13385215 AAATATCTGCCCTACGGGGATGG - Intronic
1164060527 19:21669361-21669383 ATATTTGTGCCTTTGTGAGAGGG + Intergenic
1164528618 19:29029985-29030007 AAGTTGGTGCCCTTGGGGCCTGG + Intergenic
1166811067 19:45515013-45515035 AAATGAGTGACTTTGGGGGAGGG + Intronic
925481278 2:4277025-4277047 CACTTGGTGCCCTTGGGAGAGGG - Intergenic
925484840 2:4316545-4316567 GAATCTGTACACTTGGGGGAAGG - Intergenic
927387678 2:22554343-22554365 AAACTTGAACCCTTGAGGGATGG - Intergenic
928241092 2:29587138-29587160 ATATATTTCCCCTTGGGGGAGGG + Intronic
928483954 2:31710973-31710995 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
928576913 2:32664730-32664752 ACTTTTGAGCCTTTGGGGGATGG + Intronic
930183566 2:48388447-48388469 GTATTTGTGCCCTTGTGAGAGGG - Intergenic
930422285 2:51168408-51168430 AAAATAGTGCCCTTGGGGACAGG + Intergenic
930727229 2:54694212-54694234 GAATCTGTGCACTTGGGAGAGGG + Intergenic
931423658 2:62151276-62151298 ACAGTTGAGACCTTGGGGGAAGG - Intergenic
931467600 2:62505543-62505565 AAATTTGTTCCCTGGGGTGGGGG + Intronic
931729651 2:65141640-65141662 ATATTTGTACCCTTGAGGGCAGG + Intergenic
931736399 2:65198717-65198739 GACTCTGTGCCCTTGGGGGAGGG + Intergenic
932517452 2:72367713-72367735 GAGTTTGTGCACTTGGGAGAGGG + Intronic
933387789 2:81633868-81633890 AAATTGGTGTCCTTGTGAGAAGG - Intergenic
935835675 2:107050649-107050671 AAATCTCTGCACTTGGGGGATGG - Intergenic
936641545 2:114317374-114317396 CAATCTGTGCCCTTTGGGGAAGG - Intergenic
937739362 2:125332606-125332628 GAATCTGTGCTCTTGAGGGAAGG + Intergenic
940503950 2:154528427-154528449 AAATTGGTGTCCTTGTGGGAGGG + Intergenic
941303467 2:163831132-163831154 AACTTGGTGTCCTTGTGGGATGG + Intergenic
941678603 2:168371180-168371202 AAATTGGTGTCCTTGTGGCAGGG - Intergenic
941851928 2:170191651-170191673 TAATCTGTGCACTTGCGGGAGGG - Intronic
942047778 2:172109857-172109879 GACTTTGTGGCCTTGGGGAAAGG + Intergenic
943117611 2:183692461-183692483 AAATCTGTGTACTTGGGGAAGGG - Intergenic
944133381 2:196370847-196370869 GAATCTGTGCGCTTAGGGGAGGG - Intronic
945337565 2:208610851-208610873 AACTTTGGGGACTTGGGGGAAGG - Intronic
945476139 2:210284909-210284931 AAATTTGTACCCATGGAGCAAGG + Intergenic
945803848 2:214465950-214465972 GAATCTGTGTGCTTGGGGGAGGG - Intronic
945940848 2:215948463-215948485 AAATCTGTGACCTTGGAAGAGGG + Intronic
946335714 2:219035064-219035086 AAATTGGTGACCTTGCGGGATGG - Intronic
947131032 2:226924826-226924848 GAATCTGTGTACTTGGGGGAGGG - Intronic
947955836 2:234190006-234190028 AAATTTGTTGACTTGGAGGAGGG - Intergenic
947981295 2:234412193-234412215 GAATTTGTGTCTCTGGGGGAGGG + Intergenic
948426909 2:237894387-237894409 AGATTTCTGCCATTGTGGGAAGG + Intronic
1169191797 20:3662683-3662705 CAAAGTGTGCCCTTTGGGGAGGG - Intronic
1170668262 20:18405867-18405889 GAATGTGTGCACTTTGGGGAGGG + Intronic
1172186994 20:33037027-33037049 AACATTGAGACCTTGGGGGAGGG + Intronic
1173728672 20:45313831-45313853 AAATGTCTGCCCTGGGGGCAGGG - Intronic
1175543147 20:59760829-59760851 TAATTAGTGCACTTGTGGGAAGG - Intronic
1177771191 21:25518546-25518568 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1179532872 21:42032136-42032158 AAACTCCTGCCCTTGGGGCATGG - Intergenic
1183559829 22:38563683-38563705 AAATTTGTGGAGATGGGGGAGGG - Intronic
1184336510 22:43856306-43856328 AAGACTCTGCCCTTGGGGGAGGG + Intronic
950019838 3:9779499-9779521 AAACCTGGACCCTTGGGGGAGGG + Intronic
951310371 3:21117822-21117844 GAATCTGTGCACTTGGAGGAGGG - Intergenic
951393077 3:22130630-22130652 GAATCTGTGCTCTTGGGGGAAGG - Intronic
951495168 3:23317407-23317429 CAATCTGTGCACTTGGGGGACGG - Intronic
952518013 3:34125156-34125178 GAATCTGTGCACTTGGAGGAAGG - Intergenic
952683364 3:36121704-36121726 GAATTTGTGTGCTTGAGGGAAGG + Intergenic
953217185 3:40930541-40930563 AAATCTGTGCACTTGGGAGAAGG + Intergenic
953362514 3:42310298-42310320 GAACCTGTGCCCTTTGGGGAGGG - Intergenic
954491480 3:50910728-50910750 CAATCTGTGTACTTGGGGGAGGG - Intronic
955004534 3:54956362-54956384 AAAATTGTCCCCTTGGTGGTGGG - Intronic
955819119 3:62876669-62876691 AAAGTTGTGTCCTTGAGGTATGG - Intergenic
955840197 3:63104603-63104625 AAATTTTTGCCCTTGGGAAAGGG - Intergenic
956106857 3:65828558-65828580 AGATTTCTGCCCTTGGGGTTTGG - Intronic
957270202 3:78020538-78020560 AAATTTTAGCGGTTGGGGGATGG - Intergenic
957448585 3:80346574-80346596 GAATTTGTGTGCATGGGGGAGGG - Intergenic
957672596 3:83324552-83324574 GAATATGTGTGCTTGGGGGAAGG - Intergenic
958052235 3:88363085-88363107 AAATTTTTGTGCTTGAGGGAGGG - Intergenic
958765988 3:98368354-98368376 CAATCTGTGTGCTTGGGGGAGGG - Intergenic
959126061 3:102291344-102291366 GAATCTGTGCACTTAGGGGAAGG - Intronic
959409153 3:105998418-105998440 GAATCTGTGTCCTTGGGGGAGGG - Intergenic
959806712 3:110562874-110562896 AAAGCTGTACACTTGGGGGAAGG - Intergenic
959868578 3:111300371-111300393 GAATTTGTGCACTTAGGGGAAGG - Intronic
960869899 3:122238232-122238254 AAATCTGTGCATTTTGGGGAAGG + Intronic
961339129 3:126205430-126205452 GAAATGGTGCACTTGGGGGAAGG + Intergenic
962015042 3:131430929-131430951 AAATCTGTGTACTCGGGGGAGGG + Intergenic
962031710 3:131607866-131607888 AATTTTGTGCCCTTGGTGGCTGG - Intronic
963274443 3:143316201-143316223 AAATTTGGCCCCTTGGGCAAAGG + Intronic
963528853 3:146448004-146448026 AAATCTGTGTGGTTGGGGGAGGG - Intronic
964179220 3:153864262-153864284 AAATCTGTACTCTTGGGAGAAGG + Intergenic
964259039 3:154812410-154812432 GAATCTGTGCACTTGGGAGAGGG - Intergenic
964583010 3:158260885-158260907 GAATCTGTGCACTTGGGGGAGGG - Intronic
965160814 3:165130307-165130329 TAATTGGTGTCCTTGTGGGAAGG + Intergenic
965256982 3:166425732-166425754 GAATCTATGCACTTGGGGGAAGG + Intergenic
968142792 3:196272723-196272745 AAATAAGTTCCTTTGGGGGAAGG - Intronic
971580591 4:28334509-28334531 AAATGTGCAGCCTTGGGGGATGG + Intergenic
971768358 4:30863808-30863830 AAATTTATTCTCTTGGGGGTTGG - Intronic
972021543 4:34322463-34322485 GAATCTGTGCCCTTGAGGGAGGG + Intergenic
972125401 4:35758950-35758972 AAATCTGTGCACTTTGGGGAGGG - Intergenic
973327542 4:48878603-48878625 AAATCTGTGTGCTTGGGAGAGGG - Intergenic
973852658 4:54976740-54976762 GAATCTGTGCACTTTGGGGAGGG + Intergenic
973951730 4:56022356-56022378 CAATTTTTTCCCTTGGAGGATGG - Intronic
974415083 4:61595978-61596000 GTATTTGTGCACTTTGGGGAGGG - Intronic
974893412 4:67908328-67908350 AAATTGGTGTCCTTTGGGAAGGG + Intergenic
975040129 4:69736027-69736049 GAATCTGTGCACTTGGGAGAGGG + Intronic
975357956 4:73430438-73430460 GAATTTGTTCCCGTGTGGGAGGG + Intergenic
975369599 4:73569068-73569090 GAATCTGTGCACTTGGGAGAAGG - Intergenic
975764492 4:77653143-77653165 ATATTTATGCCTTTGGGGAAAGG + Intergenic
975918266 4:79350613-79350635 AAATTTTTGTCCTTGTGAGAGGG + Intergenic
976728614 4:88240713-88240735 GAATCTGTGCACTTGGGAGAGGG - Intergenic
976912399 4:90323571-90323593 AAATTTGTGAGCTTGTGGGAGGG - Intronic
977477473 4:97530815-97530837 GAGTTTGTGCACTTTGGGGAGGG + Intronic
977527944 4:98166892-98166914 GAATCTGTGCTCTTGAGGGAGGG - Intergenic
977644387 4:99395626-99395648 CAATCTGTGTGCTTGGGGGAGGG + Intergenic
978732684 4:112048711-112048733 ATATTTATGACCTTGCGGGAGGG + Intergenic
978733684 4:112061307-112061329 GAATCTGTGCATTTGGGGGAGGG + Intergenic
979100382 4:116604808-116604830 AACTTTGTGTCCTTGCAGGAGGG + Intergenic
980146080 4:128986153-128986175 TAATTTGTGTGCTAGGGGGAGGG + Intronic
980172529 4:129306636-129306658 GAATCTGTGCACTTTGGGGAGGG - Intergenic
980442485 4:132867096-132867118 AAATCTGTGAGCTTGGGAGAGGG + Intergenic
980723638 4:136728601-136728623 AAATTGGTGTCCTTGTGGGGAGG + Intergenic
980752910 4:137115733-137115755 GAATCTGTGTTCTTGGGGGAGGG + Intergenic
981558711 4:146023834-146023856 AAATCTGTGTGCTTGGGAGAAGG - Intergenic
981558741 4:146024035-146024057 AAATTGTTGTCCTTGGGGGAGGG + Intergenic
982339720 4:154284570-154284592 GAATCTGTGCACTTGGGAGAGGG + Intronic
982754820 4:159205546-159205568 ATTGTTGTGCCATTGGGGGAGGG + Intronic
983050214 4:163037796-163037818 ACATATGTGTACTTGGGGGATGG + Intergenic
983166069 4:164478381-164478403 GAATTTGTGTGCTTGGGAGAGGG - Intergenic
984697501 4:182794092-182794114 AAACTTGTGGCCTTGGGCAATGG - Intronic
985736791 5:1587596-1587618 AAATGTGTTTCGTTGGGGGAAGG - Intergenic
986657737 5:10031602-10031624 AAATTGTTGTCCTTGTGGGAGGG + Intergenic
987496681 5:18653654-18653676 AAATCTGTGCACTTGGAAGAGGG - Intergenic
987553596 5:19415927-19415949 AAATTTGTGAACTTGGGGGTGGG + Intergenic
987564181 5:19563899-19563921 GAATCTGTGCACTTTGGGGAGGG + Intronic
987886182 5:23815885-23815907 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
987903774 5:24050009-24050031 AAATCTGTGCACTTGTGGGAGGG + Intronic
988082623 5:26433018-26433040 TAATCTGTTCACTTGGGGGAGGG + Intergenic
988265430 5:28942685-28942707 AAATCTGTGTCCTTGGGGGTGGG - Intergenic
988459696 5:31423034-31423056 AAATTTCTGCTCATGGGAGAAGG - Intronic
989241252 5:39204999-39205021 GAATTTGGGTGCTTGGGGGAGGG + Intronic
989657817 5:43762889-43762911 GAATCTGTGCACTTGGAGGAGGG - Intergenic
989779202 5:45243996-45244018 AAATTGAAGCCCTTGGGGGGAGG - Intergenic
989998760 5:50867462-50867484 TAATTTGTGTCCCTGGTGGAGGG - Intergenic
990208738 5:53458481-53458503 AAATTTTAGGCCTTGGGGGGGGG - Intergenic
992657109 5:78921890-78921912 GAATCTGTGTTCTTGGGGGAAGG + Intronic
992934415 5:81687172-81687194 GAATCTGTGCCATTGTGGGAGGG + Intronic
993171138 5:84420201-84420223 TAATCTGTGCACTTGGGAGAGGG - Intergenic
993256979 5:85604452-85604474 GAATCTGTGTCCTTGGGGGAGGG + Intergenic
993438587 5:87926637-87926659 AAATTTCTGCCCTTTGGGTAGGG - Intergenic
993580237 5:89652328-89652350 AACTTTGTGCCCTTGTTGGAGGG - Intergenic
993932317 5:93954976-93954998 GAATCTGTGCATTTGGGGGAGGG - Intronic
994233784 5:97338714-97338736 AAATCTGTGCCTTTGGGAGAGGG + Intergenic
995060317 5:107806238-107806260 AAATGTGTGCTCTCGGGGGTGGG + Intergenic
995290376 5:110444393-110444415 GAGTCTGTGCACTTGGGGGAGGG - Intronic
996180349 5:120410952-120410974 AAATGTGTGCATTTGAGGGAGGG + Intergenic
996210032 5:120797781-120797803 GAATCTGTGCCATTGGGAGAGGG + Intergenic
997059810 5:130487892-130487914 AAATTTTTGCACTTGGGAGATGG + Intergenic
997895632 5:137714023-137714045 AAATATGTGGGGTTGGGGGAGGG - Intronic
998058008 5:139095922-139095944 AAATTGGTGTCCTTGCAGGAGGG - Intronic
998090813 5:139367121-139367143 ACATTATTTCCCTTGGGGGAAGG + Intronic
999452110 5:151686266-151686288 AAATTTGTGTATTGGGGGGACGG + Intronic
1000139730 5:158390453-158390475 AAATTTGTGACCCTGCTGGATGG - Intergenic
1003084880 6:3053269-3053291 AACTTTGTACTCTTCGGGGACGG + Intergenic
1003361182 6:5426920-5426942 AAATTTGTGACATTGAGGGCTGG - Intronic
1004380371 6:15127497-15127519 AAATTTATGCTCTTATGGGAAGG - Intergenic
1005000025 6:21231117-21231139 AAATTATTGCCCTTGGAGAATGG - Exonic
1006855231 6:37128296-37128318 AGCTATGAGCCCTTGGGGGAGGG - Intergenic
1007825879 6:44600290-44600312 AGATTTCTTCCCTTGGGGAAGGG - Intergenic
1008880841 6:56378648-56378670 AACTTTCTGCCCTTAAGGGAAGG + Intronic
1009493911 6:64326765-64326787 CCATTTGTGCTGTTGGGGGAAGG - Intronic
1009744733 6:67798279-67798301 AAATCTGTGCACTTTGAGGAGGG + Intergenic
1010536118 6:77033221-77033243 ATATTTGTGACCTTGGGGTAGGG + Intergenic
1010560421 6:77341859-77341881 GAGTTTGTGCACTTGGGAGAGGG - Intergenic
1011742464 6:90376206-90376228 AAATTTGTGAGACTGGGGGAAGG - Intergenic
1011774063 6:90708482-90708504 GAATTTGGGAACTTGGGGGAGGG - Intergenic
1012047722 6:94300384-94300406 AAATTTGTGTGCTTGGGGAAGGG + Intergenic
1012224374 6:96687973-96687995 AAATCTCTGCACTTGGGAGAGGG + Intergenic
1012783126 6:103589081-103589103 AAATCTGTGTTCTTGGGGGAGGG - Intergenic
1013519528 6:110920103-110920125 GTATTTGTGCCCTTGTGAGAGGG - Intergenic
1014197086 6:118573095-118573117 AAATGTAAGCCCTTAGGGGAAGG - Intronic
1014234513 6:118939573-118939595 GAATCTGTGCACTTGGGAGAGGG + Intergenic
1015392784 6:132701829-132701851 AAATTTGTGCCCTTGGGGGAAGG + Intronic
1015460594 6:133487067-133487089 GAATCTGTGCACTTGGGGGAGGG + Intronic
1016208234 6:141496667-141496689 AAAGCTGTCGCCTTGGGGGAGGG - Intergenic
1017201853 6:151763404-151763426 TAATTTTTGCCTTTGGGGGTTGG - Intronic
1017918899 6:158854782-158854804 AAAAATGTGCATTTGGGGGAGGG + Intergenic
1021214742 7:17901628-17901650 AAATCTGTGCACTTAGGGGAGGG - Intronic
1021835687 7:24671609-24671631 AATTTTGTGGCCTTGGGTTAGGG - Intronic
1021922977 7:25505694-25505716 GAATCTGTGCACTTGGGTGAGGG + Intergenic
1021998318 7:26201590-26201612 GAATTGGGGCCCTAGGGGGAGGG - Intronic
1022052287 7:26688721-26688743 AAATTTTTGCCTTTGAGGGTAGG - Intronic
1025862069 7:65339508-65339530 GAATTTGTGTGCTTAGGGGAAGG - Intergenic
1027258209 7:76444776-76444798 GAATCTGTGCCCTGGGGGCATGG + Intergenic
1027280639 7:76607243-76607265 GAATCTGTGCCCTGGGGGCATGG - Intergenic
1027449716 7:78317521-78317543 AAATTAGAGCACCTGGGGGAAGG + Intronic
1028291346 7:89068921-89068943 GAGTTTGTGCCCTAGGGGAAGGG + Intronic
1028709786 7:93893835-93893857 AAGTTTGTGCCATTGTGTGAGGG - Intronic
1028868182 7:95737111-95737133 AAATTTGTGCCCTTGGGGGAAGG - Intergenic
1031098363 7:117448172-117448194 GAATTTGTGTGCTTTGGGGAGGG + Intergenic
1031306146 7:120130301-120130323 AAATCTGTGCACTTGGGGAAAGG + Intergenic
1031862194 7:126993655-126993677 GAATCTGTACACTTGGGGGAGGG + Intronic
1035084685 7:156247923-156247945 AAATTGGTGTCCTTGCAGGAGGG + Intergenic
1035138976 7:156738156-156738178 GAATCTGTGTACTTGGGGGAGGG + Intronic
1037033990 8:14143609-14143631 AAATTGGTGCCCTTGCAGTAGGG - Intronic
1037295518 8:17396420-17396442 GAATCTGTGCACTTGCGGGAAGG + Intronic
1037772339 8:21809899-21809921 AAATTTGTGTTGTTGGGTGAGGG - Intronic
1038874433 8:31532510-31532532 AAATGTGTGCATGTGGGGGATGG + Intergenic
1040360261 8:46658426-46658448 AAAATGGTGCCCTTGGAGGCTGG - Intergenic
1040745522 8:50636585-50636607 GAATCTGTGCTCTTTGGGGAAGG - Intronic
1041580017 8:59447692-59447714 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1042007528 8:64198100-64198122 AAAGTTGAGCCTTTGGGGAAGGG - Intergenic
1042162519 8:65911801-65911823 AAATCTGTGTGCTTGGGGGAGGG + Intergenic
1042297822 8:67241888-67241910 AAATCTGTGTACTTGGGAGAGGG + Intronic
1042761771 8:72278937-72278959 AAATTTGAGACCTTGGAGAAAGG + Intergenic
1043041970 8:75275203-75275225 GAATCTGTGCACCTGGGGGAGGG + Intergenic
1043763138 8:84094953-84094975 AAATCTGTATTCTTGGGGGAGGG - Intergenic
1044124163 8:88437323-88437345 GAATCTGTGCACTTAGGGGAGGG + Intergenic
1044230088 8:89764314-89764336 AATTTTGTGAGGTTGGGGGAGGG - Intronic
1044378296 8:91502055-91502077 AAATTTGATTCCTTAGGGGAAGG + Intergenic
1045973100 8:108102040-108102062 AAATTTTTGCATTTTGGGGAAGG + Intergenic
1046259003 8:111741346-111741368 AAATTTATGCCCTTTGTGGCTGG + Intergenic
1046811546 8:118538577-118538599 GAATCTGTGCCCTTTGGAGAGGG - Intronic
1047092758 8:121591690-121591712 AAGTTTTTACCATTGGGGGAAGG + Intergenic
1050508098 9:6368397-6368419 GAATCTGTGCACTTGAGGGAGGG + Intergenic
1050747145 9:8889621-8889643 AACTTTGGGGACTTGGGGGAAGG - Intronic
1050925203 9:11255986-11256008 TAATTTGGGCCAATGGGGGATGG - Intergenic
1051306616 9:15717162-15717184 GAATCTGTGCACTTGGGGAAGGG + Intronic
1051345603 9:16148075-16148097 AAATCTGTGAACTTGGGAGAGGG + Intergenic
1051398566 9:16654700-16654722 AAATTTGGGGGCATGGGGGATGG - Intronic
1051464940 9:17367171-17367193 AGAATTGTGCACTTAGGGGAGGG + Intronic
1051842459 9:21414006-21414028 GAATCTGTGCACTTGGGAGAGGG - Intronic
1052093879 9:24361714-24361736 GAATTTGTGCTCTTGGGAGAGGG + Intergenic
1052205020 9:25828536-25828558 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1052450604 9:28625303-28625325 GAATCTGTGCACTTGGGAGAGGG - Intronic
1054346067 9:63916424-63916446 AAATTTGTCCCCATTAGGGAGGG + Intergenic
1055580086 9:77699101-77699123 GAATCTGTGCACTTGGGAGAGGG - Intergenic
1055910961 9:81350630-81350652 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1056889818 9:90480733-90480755 AAATTTGTGCCCTTTGTGCCGGG + Intergenic
1057256733 9:93555167-93555189 AAAAATGTTCCCTTGGGGGCAGG - Intronic
1058086287 9:100752047-100752069 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1058522919 9:105829461-105829483 GAATCTGTGAACTTGGGGGAGGG - Intergenic
1058919885 9:109603481-109603503 ACATTGGTGCCCTCTGGGGATGG + Intergenic
1060627570 9:125127523-125127545 CAAATTCTGCCCTTGGGGGCAGG - Intronic
1186433921 X:9527507-9527529 AAATTGGTGTCCTTGGGGTGGGG + Intronic
1186602262 X:11050322-11050344 GAATCTGTGCACTTGGGGGAAGG - Intergenic
1186977424 X:14923102-14923124 AAAATTGTGCCCTTTAGGGACGG - Intergenic
1187723894 X:22182407-22182429 AAACCTCTGCGCTTGGGGGAAGG - Intronic
1188108410 X:26168831-26168853 AACTTTGTGTCCTTGTGGGAAGG + Intergenic
1188918007 X:35935602-35935624 AAATTGGTGTCCTTGTAGGAGGG + Intronic
1189593742 X:42542804-42542826 AAATCTGTGCACGTGGGAGAGGG + Intergenic
1189628049 X:42920718-42920740 AAATCTGTGTACTGGGGGGAGGG + Intergenic
1189640648 X:43067430-43067452 AAATCTGTGCACTTGTGGGAAGG + Intergenic
1189854237 X:45208157-45208179 GAATCTGTGTCCTTGGGGGAGGG - Intergenic
1189875796 X:45434527-45434549 GAATCTGTGTACTTGGGGGAGGG - Intergenic
1190046074 X:47112483-47112505 GAATCTGTGCACTTGGGGGCAGG + Intergenic
1190537131 X:51440569-51440591 GAATCTGTGCACTTGGAGGAGGG + Intergenic
1190588239 X:51968536-51968558 GACTCTGTGCACTTGGGGGAGGG - Intergenic
1190808473 X:53861688-53861710 CAATCTGTGTGCTTGGGGGAGGG - Intergenic
1191073018 X:56421776-56421798 AAATTGATGGCCTGGGGGGATGG - Intergenic
1191924670 X:66296651-66296673 AAATTTGTGTCTTTGGGGGAGGG + Intergenic
1193052506 X:77116086-77116108 GAATCTGTGTACTTGGGGGAGGG - Intergenic
1193052537 X:77116284-77116306 TAATCTGTGCACTTGGGGGAGGG - Intergenic
1193191227 X:78573315-78573337 GAATCTGTGCATTTGGGGGAGGG - Intergenic
1193366831 X:80644374-80644396 GAATCTATGCACTTGGGGGAAGG - Intergenic
1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG + Intronic
1194095645 X:89636005-89636027 GAATCTGTGCACTTGGGGGAGGG + Intergenic
1194211832 X:91079946-91079968 AAGTATGTGCCCCTGTGGGATGG + Intergenic
1194274924 X:91866762-91866784 AAATTTGTGTCCTTGTGGGGAGG + Intronic
1194327794 X:92541371-92541393 GAGTTTGTGCACTTGGGGGAGGG - Intronic
1194387678 X:93277550-93277572 AAATCTGTGTGCTTGGGGGAGGG + Intergenic
1195115633 X:101695684-101695706 GAATCTGTGCACTTGGGAGAGGG + Intergenic
1195290157 X:103424447-103424469 GAATCTGTGTGCTTGGGGGAGGG - Intergenic
1195314416 X:103664379-103664401 AAAATGGTGGGCTTGGGGGAGGG + Intergenic
1195501947 X:105612480-105612502 AAATTAGTGTCCTTGAAGGAGGG - Intronic
1195697894 X:107680026-107680048 TACTTTGTGCCCTGGGGGAAAGG - Intergenic
1195872247 X:109498636-109498658 TAATCTGTGCACTTGGGGAAGGG - Intergenic
1196151128 X:112375566-112375588 AACTTTGTTGCCTTGGAGGAGGG + Intergenic
1197035402 X:121868481-121868503 AAATATATTCCTTTGGGGGAGGG - Intergenic
1197177960 X:123504761-123504783 GAATCTGTGCCCTTGGGGGAGGG + Intergenic
1197399869 X:125977337-125977359 GAATCTGTGTGCTTGGGGGAGGG + Intergenic
1197429305 X:126341504-126341526 AAATTGTTGTCCTTGGGGGAGGG - Intergenic
1197487855 X:127075480-127075502 GAATCTGTGTGCTTGGGGGAGGG - Intergenic
1197725565 X:129774085-129774107 ACAATTGTCCCCATGGGGGAGGG + Intergenic
1198186823 X:134261064-134261086 AAAAGTGTGACCTTGGGGTAAGG + Intergenic
1198274125 X:135085544-135085566 GAATCTGTGCACTTGGGGGAGGG - Intergenic
1198559270 X:137830995-137831017 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1198578401 X:138036357-138036379 GTATTTGTGCACTTGGGAGAGGG + Intergenic
1198676946 X:139141142-139141164 AAGAGTGTGCCCTTGGGGAAAGG - Intronic
1198724787 X:139665493-139665515 AAATCTGTACACTTGGGAGAGGG - Intronic
1198761557 X:140038326-140038348 GAATCTGTGTCCTTTGGGGAGGG + Intergenic
1198770686 X:140126922-140126944 GAATCTGTGCACTTGGGGGAGGG - Intergenic
1198854858 X:141005220-141005242 AAATTTGTGTCCTTGCGAGGGGG - Intergenic
1198877154 X:141239923-141239945 AAATTTGTGTCCTTGCGAGGGGG + Intergenic
1198907835 X:141582149-141582171 AAATTTGTGTCCTTGCGAGGGGG + Intergenic
1198908956 X:141592275-141592297 AAATTTGTGTCCTTGCGAGGGGG - Intronic
1198918122 X:141695877-141695899 AAATTTGTGTCCTTGCGAGGGGG + Intronic
1199005607 X:142693042-142693064 GAATTTGTGCTCTTCGGAGAGGG + Intergenic
1199076419 X:143531055-143531077 AAATTTGTGTCCTTGCGAGGGGG + Intergenic
1199188944 X:144948824-144948846 GAATTTGTATGCTTGGGGGAGGG + Intergenic
1199223044 X:145339695-145339717 AAATTTGTGTACTTGGGAGAGGG + Intergenic
1200448644 Y:3297373-3297395 GAATCTGTGCACTTGGGGGAGGG + Intergenic
1200592165 Y:5088165-5088187 AAATTTGTGTCCTTGTGGGGAGG + Intronic
1200636508 Y:5660589-5660611 GAGTTTGTGCACTTGGGGGAGGG - Intronic
1200647209 Y:5800122-5800144 AAATTTGCGTCCTTGTTGGAGGG + Intergenic
1200732556 Y:6758331-6758353 AAATTTATCCTCTTGGGGAAGGG - Intergenic
1201439318 Y:13991497-13991519 AAATTGGTGTCCTTGGTGGGGGG - Intergenic
1201445255 Y:14051211-14051233 AAATTGGTGTCCTTGGTGGGGGG + Intergenic
1202093367 Y:21217373-21217395 AAATTTCTGCCCTCAGTGGAAGG + Intergenic