ID: 1015392787

View in Genome Browser
Species Human (GRCh38)
Location 6:132701847-132701869
Sequence GAAGGAAAGTACAGTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 5, 2: 26, 3: 122, 4: 509}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392772_1015392787 30 Left 1015392772 6:132701794-132701816 CCCCATCCTCCAGGTTACCACAT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392776_1015392787 24 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392774_1015392787 28 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392778_1015392787 21 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392773_1015392787 29 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509
1015392779_1015392787 13 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG 0: 1
1: 5
2: 26
3: 122
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392787 Original CRISPR GAAGGAAAGTACAGTGATTG TGG Intronic
902855946 1:19205017-19205039 GAAGGAAAATAAAGAGATAGAGG + Intronic
904695415 1:32327891-32327913 GGAGGAAAGTACAGTGAGTCAGG - Intronic
905025308 1:34845619-34845641 GAAGGACAGGACAGTGCCTGGGG + Intronic
905739815 1:40360691-40360713 GAAGGAGAGCACAGTGATTGTGG + Intronic
905740221 1:40363791-40363813 GAAGGAGAGTGCAGTGATTGTGG + Intronic
906827173 1:48993805-48993827 GAGGGAGAGTGCAGTGATTGTGG - Intronic
908089070 1:60667644-60667666 GAATGTAAATACAGTGAGTGAGG + Intergenic
908093019 1:60706647-60706669 GAGGGAAAGTGAAGTGACTGTGG + Intergenic
908276686 1:62480589-62480611 GAAGGAAGGAACACTGATAGAGG + Intronic
908397694 1:63741213-63741235 GAGGGAGAGCACAGTGATTGTGG - Intergenic
908633958 1:66141537-66141559 GAAGGAAAGGAGAGTGAGTTAGG + Intronic
908795254 1:67824825-67824847 GGAGGTAAGCACAGTGAGTGTGG + Intronic
909219963 1:72945182-72945204 GAAGGAAGGGACAGGGAGTGAGG + Intergenic
909582461 1:77253466-77253488 GAGGGAGAGTGAAGTGATTGTGG + Intergenic
909711972 1:78661726-78661748 GAAGGAAAGTATAGTGTTAAAGG + Intronic
910307631 1:85784576-85784598 AAAGGAAATTCCAGAGATTGTGG + Intronic
910422436 1:87080767-87080789 GGGGGAGAGCACAGTGATTGCGG + Intronic
910470526 1:87547746-87547768 GAGGGAGAGGACAGTGACTGTGG - Intergenic
910515490 1:88055095-88055117 GAAGGAGAGCACCGTGATTGTGG - Intergenic
910605411 1:89078246-89078268 GAAGGAAACAACAGACATTGGGG + Intergenic
910645233 1:89507247-89507269 GAAGGAAACTACAGACAGTGGGG - Intergenic
910724844 1:90327792-90327814 GAGGGAGAATGCAGTGATTGTGG + Intergenic
910867751 1:91803631-91803653 GAAGGCAAGTACATTAATTAGGG - Intronic
911011607 1:93287183-93287205 GAAGGAGAATGCAGTGATTCTGG + Intergenic
911239521 1:95449695-95449717 GAAAGAGAGCACAGTGCTTGTGG - Intergenic
911264216 1:95724601-95724623 AAAGGAAAGTACAGTAATTTGGG - Intergenic
911271405 1:95806207-95806229 GAAGGAAGGGACAGGGAGTGAGG - Intergenic
911344101 1:96675128-96675150 GAGGGAGAGCACAGTGATTGTGG - Intergenic
911900479 1:103497120-103497142 GAAGGGAAGAACAGACATTGGGG + Intergenic
912643820 1:111372274-111372296 AAGGGAGAGCACAGTGATTGTGG + Intergenic
912871406 1:113310479-113310501 GAGGGAGAGCACAGGGATTGTGG + Intergenic
913500777 1:119470765-119470787 TAAGGAGAGTAGGGTGATTGTGG - Intergenic
915005228 1:152629470-152629492 GAAAGAGAGTGCAGTGATTGTGG + Intergenic
915555719 1:156659702-156659724 GAAGGAAGGCACAGGGGTTGGGG + Intergenic
915693758 1:157717118-157717140 GAGGGAAAGCACAGTGACTAGGG - Intergenic
915752661 1:158226760-158226782 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
916501491 1:165391241-165391263 GTAGGAAAGTACAGTGAAACTGG + Intergenic
916983990 1:170170546-170170568 GAAGGAAACGACAGTCACTGGGG - Intergenic
917171676 1:172183444-172183466 TAAGGAAAATACAGTGATTCTGG + Intronic
917306126 1:173627466-173627488 GAGGGAGAGCACAGTGACTGTGG + Intronic
917397038 1:174604347-174604369 GAGGGAGAGGACAGTGATTGTGG - Intronic
917742830 1:177977718-177977740 GAAGGAAAGGACAGTTTTTAAGG - Intronic
918357891 1:183723504-183723526 GAGGGAGAGTACAGTGACTGTGG + Intronic
918847112 1:189630780-189630802 GAAGGAAAGGTCAGTGAAGGAGG + Intergenic
918868758 1:189938192-189938214 GAAGGAAACAACAGATATTGGGG - Intergenic
919047385 1:192470422-192470444 GAGGGAAAGTGAAGTGATTGTGG - Intergenic
919455769 1:197818270-197818292 GATGGAGAGCATAGTGATTGTGG + Intergenic
919835371 1:201569620-201569642 TAGGGAAGGTACAGTGATTCTGG + Intergenic
921002145 1:211055256-211055278 GAGGAAAAACACAGTGATTGTGG + Intronic
921185993 1:212669970-212669992 GAAGGAAAGGACAAAGATGGTGG - Intergenic
921746122 1:218742678-218742700 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
922137909 1:222850613-222850635 GAAGGAAACAACAGACATTGGGG - Intergenic
922256970 1:223900802-223900824 GAAGAAAAGGACAGTGAATGGGG + Intergenic
922377031 1:224979325-224979347 GAGGGAGAGTGCAGTGCTTGTGG + Intronic
922799256 1:228357212-228357234 GAAGAAAAGGACAGTGGGTGTGG - Intronic
924372645 1:243369178-243369200 CAATGAAAGTAAAGTGATAGGGG - Intronic
1062809241 10:449451-449473 GTAGGAAAGTACCGTGACTTTGG - Intronic
1062884658 10:1007059-1007081 GAAGGGAAATAAAGTGAATGAGG + Exonic
1063150531 10:3332481-3332503 GAAGGAATGTATGGGGATTGAGG - Intergenic
1064987631 10:21226676-21226698 GAGGGAGAGTAAAGTGATTGTGG - Intergenic
1065399165 10:25276821-25276843 GAAGGCAAGTAGAATGATTTGGG + Intronic
1065422774 10:25565466-25565488 ATAGGAAAGTAGAGGGATTGTGG + Intronic
1065431560 10:25662056-25662078 GAAGGAGAGTGTAGTGACTGTGG - Intergenic
1065478468 10:26166617-26166639 GAAGTAAAGTACAATCATTATGG - Intronic
1066138336 10:32475192-32475214 GAAACAAAGTTCAGTGTTTGTGG - Intronic
1066624159 10:37389516-37389538 AAAGGAAAGTACTTTGACTGGGG + Intergenic
1066649839 10:37643671-37643693 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1067032729 10:42889218-42889240 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1067523010 10:47022166-47022188 GAAGGAAAGTCAAGGGATTCTGG + Intergenic
1067967920 10:50934766-50934788 GAAGGTAAGAACAGACATTGGGG - Intergenic
1069050570 10:63788304-63788326 GAGGGAGAGCACAGTGACTGGGG + Intergenic
1070038658 10:72753038-72753060 GCAAGAAAGTTCAGTGGTTGTGG + Intronic
1070059557 10:72968676-72968698 GAGGGAAAGTACAGTAACTGGGG - Intergenic
1070464133 10:76702877-76702899 GAAGGAGAGTGCAGTGATCATGG + Intergenic
1070511151 10:77162003-77162025 GAAGGAAAGAACAGGATTTGGGG - Intronic
1072492501 10:95921318-95921340 GAGGGAGAGTTAAGTGATTGGGG - Intronic
1073743911 10:106443860-106443882 GAAGGGTAGTAGAGTGATGGAGG + Intergenic
1074302282 10:112243240-112243262 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1074601974 10:114923742-114923764 GAAGGACAGTTCAATGACTGTGG + Intergenic
1074642630 10:115404663-115404685 AAATGAAAGTACAGTAATTAAGG - Intronic
1074670050 10:115780153-115780175 GAGGGAGAGCACAGTGATTGTGG + Intronic
1075478112 10:122754110-122754132 GAAGGAAAGAACTGGGATTTGGG - Intergenic
1075496260 10:122922165-122922187 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1075830648 10:125408061-125408083 AAGGGAAAGCACAGTGATTGTGG - Intergenic
1076376708 10:129993145-129993167 GAAGGAAAGCACGGTGATTGTGG + Intergenic
1077427330 11:2489241-2489263 GAGGGAAAGTGCAGTGCTTTGGG + Intronic
1077803986 11:5571533-5571555 GGAGGAAACTTCAGTGGTTGTGG - Intronic
1077846622 11:6032295-6032317 GAAGGAAAGTAAGATAATTGAGG + Intergenic
1077911878 11:6579594-6579616 GAAGGAGAGCAGAGTGATTGTGG + Intronic
1077996142 11:7454101-7454123 AAAGGAAAGAAAAGTGACTGGGG - Intronic
1078690782 11:13578734-13578756 GAGGGAGAGTGCAGGGATTGCGG + Intergenic
1078740117 11:14058649-14058671 GAAGGAAAGTACAGAAAAAGAGG - Intronic
1078992521 11:16664386-16664408 GAGAGACAGCACAGTGATTGTGG + Intronic
1079049978 11:17145734-17145756 GAAAGAAACAACAGTTATTGTGG + Intronic
1079416300 11:20239183-20239205 GAAGGAGAGCACAGTGACTGGGG - Intergenic
1080328908 11:31112744-31112766 GAAGGAAAGTAAAAAGACTGTGG - Intronic
1080649759 11:34212697-34212719 GAAGGAAAGCACAGTGCTGATGG - Intronic
1081245652 11:40763652-40763674 AAGGGAAAGCACAGTGATTGTGG + Intronic
1081293730 11:41359733-41359755 GAAGGAAAATAAAGTGCCTGAGG + Intronic
1082721189 11:56679208-56679230 GAGGAAAAGCAAAGTGATTGTGG + Intergenic
1083430086 11:62609707-62609729 GAGAGAAAGCACAGGGATTGGGG + Intronic
1083514644 11:63245317-63245339 CATGGAAAGTAAAGTTATTGCGG + Intronic
1083528936 11:63398628-63398650 GATAGAGAGCACAGTGATTGTGG - Intronic
1084110265 11:67009751-67009773 GAAGGAGAGTCCAGCTATTGTGG + Intronic
1084452096 11:69245267-69245289 GGAGGAAAGTCCAGGGATTGGGG - Intergenic
1085161862 11:74355101-74355123 GGAGGAAACTTCAGTGGTTGTGG + Intronic
1085372404 11:76021023-76021045 GAGGGAGAGCACAGCGATTGTGG - Intronic
1085562662 11:77486631-77486653 GAGGGAAAGCACAGTGATTGTGG + Intergenic
1085572245 11:77569532-77569554 GAGGGAGAGTGCAGTGATTATGG - Intronic
1085727546 11:78967342-78967364 GAAGGAGAGTACCTTGATTATGG + Intronic
1085838043 11:79977277-79977299 CAAGGAAAATACAGTGATTAAGG - Intergenic
1086228901 11:84545302-84545324 GAAGGAAGCTACAGTGATTTTGG - Intronic
1086604415 11:88678929-88678951 GAAGGCCAGTACAGTGAATGAGG + Intronic
1087002784 11:93437511-93437533 GAAAGAAAGAAAAGTGAGTGAGG - Intronic
1088135921 11:106555114-106555136 GAAGGAGAGCACAGTGACTAGGG - Intergenic
1088529064 11:110788300-110788322 GGAGGAAACTTCAGTGGTTGTGG - Intergenic
1088944583 11:114496314-114496336 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1089290758 11:117436826-117436848 GAAACAATGCACAGTGATTGAGG + Intronic
1089687527 11:120165845-120165867 GAAGGAAAGAACAGACACTGGGG - Intronic
1089905259 11:122031694-122031716 GAAGGAAACAACAGACATTGGGG + Intergenic
1089935077 11:122356268-122356290 GGAGCAAAGTAGAGTGAGTGGGG - Intergenic
1090210493 11:124917567-124917589 GAGGGAGAGTGCAGTCATTGTGG - Intergenic
1090234194 11:125134361-125134383 GAAGGACATTACAGTGGATGAGG - Intergenic
1092129369 12:6098173-6098195 GAAGGAAAGTTAACTGTTTGGGG + Intronic
1093315893 12:17648972-17648994 GATAGAAAGTAGATTGATTGTGG + Intergenic
1093633234 12:21435182-21435204 GAAAGAAAGAAAAGTGGTTGGGG - Intergenic
1094276542 12:28683117-28683139 GGAGGAAAGTAAAATGATTTTGG + Intergenic
1094795743 12:33970273-33970295 AAAGGAAAACAAAGTGATTGAGG - Intergenic
1095099851 12:38169160-38169182 GAAGGAAACAACAGACATTGGGG - Intergenic
1095141729 12:38672276-38672298 GAAGAAAAGGACAGTCATTTAGG + Intronic
1095397740 12:41779879-41779901 GAGTGAAGGTACAGTGATGGTGG - Intergenic
1095421121 12:42024687-42024709 GAAGGAAAGCTCTGTAATTGGGG - Intergenic
1096860759 12:54526234-54526256 GAAGAAAAGCACAGTAATTAGGG + Intronic
1097816639 12:64081801-64081823 GAAAGAAGGTACAGTCAATGTGG + Intronic
1098103346 12:67042471-67042493 GAATGAAATTACAGGGATTGTGG - Intergenic
1098286004 12:68907589-68907611 GAAAGGAAGTGCAGTGATTTGGG + Intronic
1098582865 12:72121521-72121543 GAAAGAGAGCACAGTGATTGCGG - Intronic
1099523212 12:83689422-83689444 GAAAGACAGTGCGGTGATTGTGG + Intergenic
1101696983 12:107135861-107135883 TAAAGAAAGTGCAGTGTTTGTGG - Intergenic
1101863671 12:108503500-108503522 GAAAGAAAGTACAATGGTGGTGG + Intergenic
1103896889 12:124278911-124278933 GAAGGAAAATACAGCAATTTAGG + Intronic
1104238589 12:126964013-126964035 GAAGGAAAGGAGAGTGAGGGAGG + Intergenic
1104342088 12:127959806-127959828 GAATAAAACTACTGTGATTGAGG + Intergenic
1104417009 12:128603889-128603911 TAAGGAAAGGACTCTGATTGTGG + Intronic
1104827645 12:131724990-131725012 GAAGGAAAGAGCAGTGATTCTGG + Intronic
1105498148 13:20948594-20948616 GGAGGAAACTTCAGTGGTTGTGG - Intergenic
1106068470 13:26382010-26382032 GCAGGATAGTACAGTGAGTAAGG + Intronic
1106764843 13:32903381-32903403 AAAGGAAAGCACAGTGAGTGCGG + Intergenic
1107349272 13:39497255-39497277 GCCGGTAAGTACAGTGCTTGTGG - Intronic
1107808347 13:44175548-44175570 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1107967961 13:45614517-45614539 GAGGGAAAGTGAAGTGATGGGGG - Intronic
1108889907 13:55244579-55244601 GAGGGACAGCAAAGTGATTGTGG + Intergenic
1108972925 13:56400618-56400640 GAAGGAGATCACAATGATTGTGG + Intergenic
1109211363 13:59538963-59538985 GAGGGAAAGCGCAGTGACTGGGG - Intergenic
1109533242 13:63681753-63681775 TAAGGCAAGTACAGTAATTTTGG - Intergenic
1109890910 13:68613282-68613304 GAAGGAAACAACAGACATTGGGG - Intergenic
1109961761 13:69640025-69640047 GAGGGAGAGCACAATGATTGCGG - Intergenic
1110448877 13:75618613-75618635 GAGGGAGAGTAGAGTGATTATGG - Intergenic
1110550580 13:76807127-76807149 GAGGGAAAGAACAGAGATTTGGG + Intergenic
1111085921 13:83374666-83374688 GAAAGAAAGAGCAGGGATTGTGG - Intergenic
1111446692 13:88355501-88355523 GAAGGAGAGCAAAGTGAGTGTGG + Intergenic
1111639192 13:90946624-90946646 GAGGGAGAGCATAGTGATTGTGG + Intergenic
1111713506 13:91847915-91847937 GATGGAGAGTACAGAAATTGAGG - Intronic
1111727196 13:92027413-92027435 GAAGGAAATTACAATATTTGAGG + Intronic
1112944500 13:104910749-104910771 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1114787110 14:25613550-25613572 GAAGGAAACAACAGCCATTGGGG + Intergenic
1115133882 14:30086205-30086227 GAGGGAGAGCACAGTGACTGGGG + Intronic
1115221176 14:31060217-31060239 GATGGAAAATACAGTGTTTGTGG + Intronic
1115925255 14:38425805-38425827 GAGGAAGAGCACAGTGATTGTGG - Intergenic
1116035270 14:39619724-39619746 GATCGAAAGTACAGTATTTGAGG + Intergenic
1116275724 14:42828431-42828453 GAGGGAGACCACAGTGATTGTGG - Intergenic
1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG + Intergenic
1117068344 14:52033034-52033056 GAAGCCAAGTTCAGTGAATGGGG - Intronic
1117107800 14:52416291-52416313 GAATGAAAGTTCAGTATTTGTGG - Intergenic
1117208573 14:53470824-53470846 GAGAGAGAGCACAGTGATTGTGG - Intergenic
1117607109 14:57440960-57440982 GAGAGAAAGAACAGTGATTGTGG - Intergenic
1118034283 14:61849624-61849646 GAGGGAGAGCATAGTGATTGTGG - Intergenic
1118121160 14:62844903-62844925 GAAGGAAATCTCAGTCATTGGGG + Intronic
1118431285 14:65720950-65720972 GAGGGGGAGCACAGTGATTGTGG - Intronic
1118680019 14:68231298-68231320 GAAGGAAAGTGGAGTGGTTAAGG - Intronic
1119112790 14:71990601-71990623 GAAGGAATATGCAGAGATTGGGG - Intronic
1120107859 14:80516745-80516767 GAGAGAGAGAACAGTGATTGTGG - Intronic
1120344523 14:83268773-83268795 GAAAGAAAGAACAGTGAGTGTGG - Intergenic
1120922310 14:89766126-89766148 GAAGGGAAGAACAGGCATTGGGG + Intergenic
1121509068 14:94498940-94498962 GAAGGAGAGGAGAGTGATAGAGG + Intronic
1125122090 15:36173250-36173272 GAAGGAAAATACTGTATTTGGGG - Intergenic
1126469128 15:48988200-48988222 ATAACAAAGTACAGTGATTGGGG + Intergenic
1126625516 15:50682865-50682887 GAAGCAAAATTCAGTGGTTGAGG - Intronic
1126706748 15:51413489-51413511 GAGGGAGAGGACAGTAATTGTGG + Intergenic
1128053033 15:64680362-64680384 TAAGAAAAGTACAGTGATGCTGG + Intronic
1128611734 15:69079324-69079346 GAAGGAAAGTACTGTGAAGAGGG + Intergenic
1129049016 15:72762505-72762527 GAAAGGAAGTAAAGTGGTTGGGG - Intronic
1129061805 15:72866469-72866491 GAAGGAAAATACAGGGAGAGGGG + Intergenic
1129152830 15:73699743-73699765 GAGGGGAGGGACAGTGATTGTGG + Intronic
1129972247 15:79789045-79789067 GAAAGAAAGTGCATAGATTGAGG + Intergenic
1130046959 15:80453094-80453116 GAAGGAAAGCACAGTGGTGCAGG - Intronic
1130089572 15:80808941-80808963 GAAAGAAATGCCAGTGATTGGGG + Intronic
1130240048 15:82179651-82179673 GAAGGAGATTTCAATGATTGTGG - Intronic
1130877583 15:88028022-88028044 GAAGGAAAGGAGAGGGAGTGAGG + Intronic
1131944799 15:97608396-97608418 GAAGGAAAGTGCAGTGATTGTGG + Intergenic
1135423242 16:22318439-22318461 GGAGCAGAGCACAGTGATTGAGG + Intronic
1137018642 16:35400352-35400374 GAATGAAAGTAAAGTGAAAGGGG - Intergenic
1137250440 16:46737117-46737139 GCAGGATGGTGCAGTGATTGGGG + Intronic
1137389929 16:48072766-48072788 GAAGGAAAATAAAGCTATTGTGG + Intergenic
1138845059 16:60554981-60555003 GAGGGAGAGTGCAGTGATAGGGG - Intergenic
1138890837 16:61142467-61142489 GAGGGAGAGTGCAGAGATTGTGG - Intergenic
1138922714 16:61552155-61552177 TAAGGAAACTAAAGTAATTGAGG + Intergenic
1139005042 16:62559488-62559510 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
1139782340 16:69362194-69362216 GCAGGAAAGTACAGAGCTTATGG - Intronic
1140608327 16:76567656-76567678 GAAGGAAATTACAGGGAATGGGG - Intronic
1143413584 17:6728428-6728450 GAGGGAGAGTAGAGTGATTGTGG + Intergenic
1146158271 17:30542558-30542580 GAAGGTAAGTACAGTGCCTCAGG - Intergenic
1146242679 17:31244617-31244639 GACGGACAGCACAGTGATTATGG - Intronic
1146612145 17:34316247-34316269 AAAGAAACGTACAGTGATAGAGG - Intergenic
1147970489 17:44217023-44217045 AAATGAAGGTACAGTGATTCAGG + Intronic
1148474360 17:47917134-47917156 GGAGGACAGTACAGGGAGTGTGG - Intronic
1148865226 17:50624808-50624830 GAAGGAAAGACCAGAGACTGGGG - Intronic
1149138818 17:53404561-53404583 GAAGGAAAGTACAATGAAAATGG - Intergenic
1149188435 17:54029952-54029974 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1149417117 17:56470838-56470860 GAAGGAAAAGAGAGTTATTGTGG + Intronic
1149690241 17:58569458-58569480 GTAGGAAAGGAAAGGGATTGGGG - Intronic
1150349061 17:64428444-64428466 TAAGGAAAGTACAATGTTTTTGG - Intergenic
1150870896 17:68910320-68910342 GAGGGAGAGGACAGTCATTGTGG + Intronic
1153326558 18:3826628-3826650 GAAGGTGAGGACAGTGATTTGGG + Intronic
1153332741 18:3890461-3890483 GAAGGAAGGGGCAGTGTTTGAGG - Intronic
1153356708 18:4144414-4144436 GAGGGAGAACACAGTGATTGTGG - Intronic
1153429353 18:4999139-4999161 GAGGGAGAGTGCAGTGACTGAGG + Intergenic
1155443291 18:25884415-25884437 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1156032707 18:32731455-32731477 GAAGGAAACAACAGAGACTGGGG + Intronic
1157285550 18:46374924-46374946 GTAGGGAAGTGCAGTGACTGGGG - Intronic
1157879196 18:51304112-51304134 GAAGGAGAGTGCAGTGATTGTGG + Intergenic
1158073690 18:53503826-53503848 GAAGGAAAATATAGTGCTTATGG - Intronic
1158205363 18:54986713-54986735 GAGGAAAAGTACAGCGATTAAGG + Intergenic
1158225112 18:55192744-55192766 GAAGGAGATTAAAGTGACTGAGG + Intergenic
1159339798 18:67119810-67119832 GACGGAAAGCTCAGTGATTGGGG - Intergenic
1159446199 18:68544531-68544553 TCAGGAGAGTGCAGTGATTGTGG + Intergenic
1159523272 18:69554252-69554274 GAAGGAATGTATTGGGATTGGGG - Intronic
1159533258 18:69682791-69682813 AAAGGAAAGTACTGTGGTAGAGG + Intronic
1160142291 18:76336372-76336394 GAAGGCAAGTCCACTGAATGCGG + Intergenic
1160624539 18:80193983-80194005 GATGGAAAGTACAGAGATATGGG + Intronic
1160637535 19:90936-90958 GAAGGAAACAACAGGCATTGGGG + Intergenic
1162596030 19:11629986-11630008 GAGGGAGAGCGCAGTGATTGTGG + Intergenic
1165261768 19:34624956-34624978 AAATGAAAGTACAGTGTTGGAGG + Intronic
1168433899 19:56302650-56302672 GAAGGAAAGAACAGGGAGGGGGG - Intronic
1168453821 19:56488749-56488771 GCAGAAAAGTGCAGAGATTGAGG + Intergenic
1168552163 19:57305360-57305382 GAATGAAAGGTCAGGGATTGAGG + Intergenic
925484839 2:4316527-4316549 GAAGGACAGTACAGTAATTGTGG - Intergenic
925506440 2:4569892-4569914 GAGAGAAAACACAGTGATTGTGG - Intergenic
925518490 2:4711732-4711754 GAAGAAAAGTAGAGTTTTTGAGG + Intergenic
926518749 2:13883411-13883433 GAGGGAGAGCACAGTGATTGCGG + Intergenic
928468049 2:31541775-31541797 AATGGACAGTACAGTGATTGTGG + Intronic
928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
928544665 2:32318324-32318346 GAAGGAGAGTACAGAGATTTGGG + Intergenic
928674505 2:33637152-33637174 GTAGGAAACTTCAGTGGTTGTGG + Intergenic
929281838 2:40088204-40088226 GAAGGAAAGTGCAGTGACTGTGG - Intergenic
930288944 2:49468770-49468792 GAGGGAGAGCACAGTGATTGTGG - Intergenic
930439785 2:51391221-51391243 GAGGGAGAGTACAGTGACTGGGG - Intergenic
930731866 2:54735597-54735619 GATGGAAAATACAGCCATTGAGG + Intronic
930895547 2:56441413-56441435 GAGGTAGAGCACAGTGATTGTGG - Intergenic
930981272 2:57528780-57528802 GAGGGAGAGTTAAGTGATTGTGG - Intergenic
931012287 2:57930367-57930389 GAGGGAGCGCACAGTGATTGTGG - Intronic
931202871 2:60117056-60117078 GAAGGAAATAACAGACATTGGGG - Intergenic
932043661 2:68325362-68325384 GAAGAAAAATACAGTGAGTGAGG - Intergenic
932841673 2:75088830-75088852 GAAGGAAATTGCAGGGAGTGAGG - Intronic
932889378 2:75579002-75579024 GAGAGAAAGTGCAGTGATTGTGG + Intergenic
933271316 2:80235982-80236004 GAAGGAAACAACAGACATTGGGG - Intronic
934035958 2:88088692-88088714 GCAGGAAGGGATAGTGATTGGGG - Intronic
936703806 2:115045581-115045603 GAGGGTGAGTGCAGTGATTGCGG - Intronic
936940505 2:117879298-117879320 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
938587635 2:132707206-132707228 GGGGGAAAGTGCAGTGACTGTGG + Intronic
939053528 2:137334295-137334317 GAGGAAAAGAACAGTGATGGTGG - Intronic
939066930 2:137494836-137494858 GAATGAAAGTATACTGTTTGTGG - Intronic
941270572 2:163422247-163422269 GGGGGAAACTACAGTGTTTGGGG + Intergenic
941332310 2:164193894-164193916 GAAGGAAACAACAGACATTGAGG + Intergenic
941509696 2:166390203-166390225 GATAGAAAGTCAAGTGATTGCGG - Intergenic
941742137 2:169046598-169046620 GAGGGAGAGCACAGTGACTGTGG + Intergenic
941746095 2:169088293-169088315 GAGGGAGAGCACAGTGATTGTGG - Intronic
941851925 2:170191633-170191655 GAGGGAGAGCACAGTGATTGGGG - Intronic
942399362 2:175585048-175585070 AAAGGAGAGTACAGATATTGAGG - Intergenic
942729692 2:179050800-179050822 AAAGGAAAGTACTGTGCTTCAGG + Intergenic
942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG + Intergenic
943628012 2:190220501-190220523 GAAGGAAAGAAAAATGATTAAGG + Intronic
943844981 2:192634469-192634491 GAGGGAGAGTACAGTGATTCTGG + Intergenic
944133380 2:196370829-196370851 GAGGGAGAATGCAGTGATTGTGG - Intronic
944133792 2:196375996-196376018 GAAGGAACGTAGACTGATAGAGG - Intronic
944616549 2:201465910-201465932 GAGGGAGAGTGCAGTGATTGTGG - Intronic
944760239 2:202807309-202807331 GAGGGAGAGTGCAGTGATTGTGG + Intronic
944928907 2:204495823-204495845 GAAGGAAAAAAGAGTGATTGTGG - Intergenic
945278109 2:208008730-208008752 GAAGAAAACTTCAGTGAATGTGG - Intronic
945680276 2:212905425-212905447 CAAGGAATGTACAGTATTTGGGG - Intergenic
946681616 2:222222701-222222723 GGAGGAAAGCACTGTGTTTGGGG + Intronic
947009274 2:225547617-225547639 GAAGGAGAGTATAGTGATTGTGG - Intronic
947131031 2:226924808-226924830 GAGGGAGAGCACAGTGATTGTGG - Intronic
947281041 2:228455146-228455168 GAAGGAAAGAACAGACATGGGGG - Intergenic
948030024 2:234809804-234809826 GGAGGAAACTACAGTGATTTGGG - Intergenic
948257156 2:236576953-236576975 GAAGGAAAGTACAGTGAAAAGGG - Intronic
948614585 2:239190332-239190354 GGAGGAAGGAACAGGGATTGTGG - Intronic
1168748202 20:263169-263191 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1168900047 20:1355542-1355564 GGAAGAGAGCACAGTGATTGTGG - Intronic
1169988612 20:11474247-11474269 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1170379089 20:15736718-15736740 GATGGAAAATACAGTATTTGAGG + Intronic
1170668265 20:18405885-18405907 GAGGGAGAGCACAGTGACTGGGG + Intronic
1170709363 20:18776128-18776150 GAGGGAGAGTGCAGTGATTATGG - Intergenic
1170864222 20:20138509-20138531 GAGAGAAAGTGCAGTGACTGTGG - Intronic
1172674916 20:36662206-36662228 AAAAGAAAAAACAGTGATTGTGG - Intronic
1172724697 20:37029366-37029388 GAATGAAAATACAGTATTTGAGG - Intronic
1172761208 20:37323776-37323798 GAAGGAAACAACAGACATTGGGG + Intergenic
1173779820 20:45746023-45746045 GGAGGAAACTTCAGTGGTTGTGG - Intergenic
1173840633 20:46154491-46154513 GAAGGAGAGGAAAGCGATTGGGG + Intergenic
1177222331 21:18210292-18210314 GAGGGGAAGTGCCGTGATTGTGG - Intronic
1178087991 21:29132070-29132092 GAAGGAAAGTAGAGGGTTTAGGG + Intronic
1178701450 21:34836625-34836647 GAAGGCAGGAACAATGATTGTGG + Intronic
1179652381 21:42820034-42820056 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1183246864 22:36700571-36700593 GAAGAAAAGCAAAGTGAATGAGG - Intronic
1183552564 22:38499451-38499473 GAAGGAGATTACAGTGAGGGGGG - Exonic
1184918411 22:47589058-47589080 ACAGGAATGTACAGTGAGTGGGG - Intergenic
949623099 3:5838017-5838039 GAAGGATAGCAAAATGATTGTGG - Intergenic
949829394 3:8197632-8197654 GAGGGAGAGCACAGTGACTGTGG - Intergenic
951029400 3:17864125-17864147 GAGGGAGAGCACAGTGACTGTGG - Intronic
951129821 3:19029371-19029393 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
951255052 3:20439050-20439072 GAAGGAGAGGACAATGACTGGGG + Intergenic
951271337 3:20628375-20628397 GAAGGAAACCACAGACATTGGGG - Intergenic
951437097 3:22677189-22677211 CAGGGATAGCACAGTGATTGTGG - Intergenic
951688734 3:25373373-25373395 GAAGGAGAATGCAGTGAGTGAGG + Intronic
952683365 3:36121722-36121744 GAAGGAGAGCAAAGTGAGTGTGG + Intergenic
952688487 3:36176246-36176268 GAGGAAAAGTGCAGTGATTGTGG - Intergenic
952725638 3:36581815-36581837 AAGGGAGAGTACAGTAATTGTGG + Intergenic
953184557 3:40626004-40626026 GAAGGAGAGTAGAGTGTTTGAGG + Intergenic
953217187 3:40930559-40930581 GAAGGAGAGCACAGTGACTAGGG + Intergenic
954350741 3:50041385-50041407 GAAAGAAAGTACAGTGGCTAAGG - Intronic
955057523 3:55470024-55470046 TATAGAAAGTACAGTGATTCTGG - Exonic
955126899 3:56121815-56121837 CAAGGAAACTACAATGTTTGAGG + Intronic
955510611 3:59676848-59676870 CATGGAAAATACAGTGATAGAGG - Intergenic
955585333 3:60471513-60471535 GAAGGAGAGTGCAGTGATTGTGG - Intronic
956641999 3:71424203-71424225 GAAGGAAGGGACAATGATTTTGG + Intronic
957018976 3:75102115-75102137 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
957131922 3:76233993-76234015 GAAGGAAACAACAGATATTGGGG - Intronic
957485588 3:80858412-80858434 GAGGGAGAGCACAGTGATTGAGG + Intergenic
957538099 3:81532021-81532043 GAGGGAAAACACAGTGACTGTGG - Intronic
957907710 3:86578953-86578975 GAGGGAGAGCACAGTGACTGGGG - Intergenic
957965723 3:87320983-87321005 GAGGGAGAGTACAGTGATTGTGG + Intergenic
958620668 3:96555238-96555260 GAAGAAGAGTACAGTGAATGTGG - Intergenic
958760054 3:98296222-98296244 GAGGGAGAGAACACTGATTGTGG + Intergenic
958765987 3:98368336-98368358 GAGGGAGAGTGAAGTGATTGTGG - Intergenic
958839403 3:99185925-99185947 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
959126060 3:102291326-102291348 GAAGGAGAGCACAGTGATTGTGG - Intronic
959806711 3:110562856-110562878 GAAGGAGAATGCAGTGATTGTGG - Intergenic
959868577 3:111300353-111300375 GAAGGAGAGCACAGTGATTGTGG - Intronic
959964173 3:112334818-112334840 GAAACAAAACACAGTGATTGAGG - Intronic
960404028 3:117238061-117238083 AAGGGACAGCACAGTGATTGTGG + Intergenic
960818340 3:121697960-121697982 TAAGGAAAGTGAAGTGCTTGAGG - Exonic
961505933 3:127370460-127370482 AAACGAAAGTGCAATGATTGGGG - Intergenic
962638918 3:137362310-137362332 GAAGCAGAGTAAAGTAATTGTGG - Intergenic
962767472 3:138579076-138579098 GAAGTAAAGTGCAGTGACTGTGG + Intronic
962997016 3:140639910-140639932 GAAGGAAAGAACAGATACTGGGG - Intergenic
962997975 3:140650719-140650741 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
963443615 3:145373903-145373925 GAGGGATAGCACAGTGATTGTGG + Intergenic
963528852 3:146447986-146448008 GAGGGAGAACACAGTGATTGTGG - Intronic
963873177 3:150442022-150442044 AAAGGATAGTACACTGAATGAGG - Intronic
964140889 3:153397456-153397478 AAAGGAGAGCAAAGTGATTGTGG - Intergenic
964179221 3:153864280-153864302 GAAGGAAAGCACAGTGATTTAGG + Intergenic
964259038 3:154812392-154812414 GAGGGAGAGCACAGTGATTGTGG - Intergenic
964583009 3:158260867-158260889 GAGGGAAAGTACAGTGATTGTGG - Intronic
965066117 3:163850946-163850968 GAAGAAAAGTACTTTGAATGAGG - Intergenic
965145586 3:164898057-164898079 GAAGGAAAGTAATGTGGGTGAGG - Intergenic
965256983 3:166425750-166425772 GAAGGAGAGCACAGTGACAGTGG + Intergenic
965264051 3:166518183-166518205 GAGGGAAAGTGCAGTTACTGTGG + Intergenic
965663041 3:171062608-171062630 GGAGGAAGGTAAAGTGATTAGGG + Exonic
965844394 3:172945579-172945601 GAGGGAGAATACAGTAATTGTGG + Intronic
965853941 3:173065697-173065719 GAGGGAAAGTAAAGTGAGTGTGG + Intronic
965863413 3:173174643-173174665 GAAGGATAGTGAAGTGGTTGGGG - Intergenic
966141829 3:176766298-176766320 GAAGAAGAGTGCAGGGATTGTGG + Intergenic
966328904 3:178789596-178789618 GGAGAAGAGCACAGTGATTGTGG + Intronic
967141971 3:186569063-186569085 GAGGGAGAGTACAGTGTTTCAGG + Intronic
967677359 3:192316457-192316479 TAAGGAGAGTACAGTGGTTGTGG + Intronic
967697062 3:192544178-192544200 GAGGGAGAGCACAGTGATTGTGG - Intronic
968682153 4:1928773-1928795 GAAGGAATGTGCTGTGTTTGAGG + Intronic
968774919 4:2535109-2535131 AAAGGAAAGGACAGGGGTTGAGG + Intronic
969722803 4:8902061-8902083 CAGGAAAATTACAGTGATTGAGG + Intergenic
970007201 4:11423110-11423132 TTAGGCAACTACAGTGATTGAGG - Intronic
970462161 4:16285225-16285247 GAAAGAACTTACAGTGACTGGGG - Intergenic
970963232 4:21897958-21897980 GAGGGAAAGTGCAGTGATTATGG + Intronic
971508754 4:27397766-27397788 GAAGGAAAGGACAGTAAATTTGG - Intergenic
972125400 4:35758932-35758954 GAGGGAGATTGCAGTGATTGTGG - Intergenic
972194322 4:36634974-36634996 GAAAGAAAGAAAAGTTATTGTGG + Intergenic
972253677 4:37331878-37331900 AAGGGAGAGTACAGTGATTGTGG + Intronic
972271201 4:37512036-37512058 GAGGGAGAGCACAGTGATTGTGG - Intronic
972278569 4:37582067-37582089 GAGGGAGAGTACAGTGATTTGGG - Intronic
972579053 4:40379168-40379190 GGAGGACAGTGCAGTGATTATGG + Intergenic
973060525 4:45718569-45718591 GAGGGAAAGTGAAGTGATTGTGG + Intergenic
973169469 4:47121266-47121288 GAAGAAAAGCACAGCAATTGTGG - Intronic
973287946 4:48440429-48440451 GAGGGAGAGCACAGTGACTGTGG - Intergenic
973348442 4:49082257-49082279 GAGGGAAAGTGCAGTGATTGTGG + Intergenic
973919939 4:55674327-55674349 GAAGGAGAGTACAGTGATTGTGG - Intergenic
974266904 4:59597703-59597725 GAAGGATAGTGCAGGGACTGTGG + Intergenic
975024490 4:69531889-69531911 GAAGGAAAGCAGAGTGACAGGGG - Intergenic
975196017 4:71524601-71524623 GAATCAAAGTACAGTGAATTAGG + Intronic
975295138 4:72726122-72726144 GAGGGAGAGCACAGTGATTGTGG + Intergenic
975300955 4:72790835-72790857 GAAGGACAGTACTGGGTTTGAGG + Intergenic
975314343 4:72933900-72933922 GAAGGAGAGCACAGCGATTGTGG - Intergenic
975437986 4:74376005-74376027 TAAGGAAAGTCCAGTCTTTGTGG + Intronic
975702789 4:77082614-77082636 GACAGAAAACACAGTGATTGAGG - Intergenic
976443704 4:85106468-85106490 CAGGGAAAGAACAGTGATTTTGG - Intergenic
976687443 4:87830548-87830570 GAAGGAAACAACAGACATTGGGG + Intronic
977278420 4:95008306-95008328 GAAGGAAAGTAGAGTGGTTAAGG - Intronic
977632138 4:99254898-99254920 GAAGGAGAGTAGAATGAGTGTGG - Intergenic
977644388 4:99395644-99395666 GAGGGAGAGTGCAGTGATAGTGG + Intergenic
978654251 4:111048210-111048232 GAGGGAGAGCACAGTGATTGTGG + Intergenic
979111270 4:116761151-116761173 GAGGGGAAGCACGGTGATTGTGG + Intergenic
979238958 4:118431673-118431695 GGAGAAAAGGACAGTGAATGGGG - Intergenic
979504553 4:121480563-121480585 GAAGGAGAGCACAGTGATGGGGG - Intergenic
979565190 4:122146463-122146485 GAAGGAGAGTGCAGTGATTGTGG - Intergenic
979945724 4:126829534-126829556 CAGGGAAAGCACAGTGATTGCGG + Intergenic
980172526 4:129306618-129306640 GAGGGAGAGCACAGTGACTGGGG - Intergenic
980712637 4:136590670-136590692 GAAGAAGAGCACAGTGATTGTGG + Intergenic
981140121 4:141258676-141258698 GAGGGAGAACACAGTGATTGTGG + Intergenic
981394596 4:144233254-144233276 GAGGGACAGTGCATTGATTGAGG + Intergenic
981871198 4:149487738-149487760 GAAGGAGAGTGCAGTGACTAGGG - Intergenic
981955022 4:150460785-150460807 GAAGGAAAATAGAGAGTTTGAGG - Intronic
982421577 4:155205002-155205024 AATGGAAAATACAGTGTTTGCGG - Intergenic
982683487 4:158459944-158459966 GAAGGAGAGTGCAGTGGCTGGGG - Intronic
983120439 4:163877563-163877585 TAAGGAAAGTAAAGAGATTAGGG - Intronic
983338183 4:166422025-166422047 GAGGGAGAGCACAGTGACTGTGG - Intergenic
983388810 4:167102566-167102588 GAGACACAGTACAGTGATTGTGG + Intronic
983501334 4:168503266-168503288 GAAGCAAATTATATTGATTGGGG + Intronic
983657850 4:170101029-170101051 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
984306424 4:177997826-177997848 GAGGAAAAGTATAGTGCTTGAGG - Intergenic
984529877 4:180902738-180902760 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
986085204 5:4437946-4437968 AAGGGAGAGTGCAGTGATTGTGG - Intergenic
986552858 5:8978326-8978348 GAAGGAAAGCACAGTGAAAAAGG + Intergenic
986901912 5:12445791-12445813 GAAGGAAAGGAGAATGAATGAGG + Intergenic
987383473 5:17307491-17307513 GAAGGAAACGACAGATATTGGGG - Intergenic
987517276 5:18928058-18928080 GAGGGTAATTAAAGTGATTGTGG - Intergenic
987585458 5:19849382-19849404 GAAGAAATGTGCAGTGAATGGGG + Intronic
987616002 5:20275876-20275898 GAGGGAGAGTGCAGTGATTTGGG + Intronic
987678369 5:21104918-21104940 GAAGGAAAATATACTTATTGTGG - Intergenic
987886183 5:23815903-23815925 GAGGGAGAGTAAAGTGAGTGTGG + Intergenic
989646912 5:43644238-43644260 GAAGGAAGGTTCAGTTGTTGTGG + Exonic
989657816 5:43762871-43762893 GAGGGAAAGCACAGTTACTGTGG - Intergenic
989672497 5:43935504-43935526 GAGGGAAAGAACAGCAATTGTGG + Intergenic
990586363 5:57215291-57215313 GAGGGAAAGTAAAATGATTGAGG + Intronic
990771534 5:59251991-59252013 GAAGGAAACAACAGACATTGGGG + Intronic
991209250 5:64085213-64085235 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
991395411 5:66199281-66199303 GAGGGAGAGTACAGCAATTGTGG - Intergenic
992531914 5:77660117-77660139 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
992657111 5:78921908-78921930 GAAGGAAGGTGTAGCGATTGTGG + Intronic
992808177 5:80359363-80359385 GGAGGAAACTTCAGTGGTTGTGG - Intergenic
992934417 5:81687190-81687212 GAGGGAGAGCACAGTGACTGTGG + Intronic
993279263 5:85904749-85904771 GAGGGAAAGTGCAGTGACTGAGG + Intergenic
993337695 5:86681685-86681707 GAAACAGAGTACAGTGATGGAGG - Intergenic
993932316 5:93954958-93954980 GAGGGAGAGCACAGTGACTGTGG - Intronic
993981134 5:94545037-94545059 GAGGGAGAGCACAGTGACTGGGG + Intronic
994226049 5:97253170-97253192 GAGGGAAAGTACAATTACTGGGG + Intergenic
994320335 5:98387315-98387337 GAGGGGAAGTGCAGTGATTGTGG - Intergenic
994724450 5:103417497-103417519 GAGGGAAAGTAGAGTGAATCTGG + Intergenic
995147002 5:108797541-108797563 GAAAGAGAGCACTGTGATTGTGG - Intronic
995264708 5:110144685-110144707 GAAGGAGAAGACAGTGATTAGGG + Intergenic
995268743 5:110195730-110195752 GAGGAAGAGTGCAGTGATTGTGG - Intergenic
996034322 5:118740870-118740892 GAATGAAAGGACAGGGATAGAGG + Intergenic
996058327 5:119004760-119004782 AAAGGAAAGAAGAGTGGTTGTGG - Intergenic
996166513 5:120229827-120229849 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
996452405 5:123640496-123640518 GAAAGAAAGGAGAGAGATTGAGG - Intergenic
996659857 5:125988955-125988977 GAGGGACAGCAAAGTGATTGTGG - Intergenic
996744865 5:126838898-126838920 GAAGGAAAGAACAGACAGTGGGG - Intergenic
996906692 5:128608972-128608994 GAAGAACAGCACAGTGACTGTGG - Intronic
997706050 5:135953525-135953547 GAAGCAAAGTATAATGATGGAGG - Intronic
998157169 5:139793613-139793635 GAAGGAAAGAACAGGGAAAGGGG - Intergenic
998748375 5:145288419-145288441 AAAGTAAAATACAGTGATGGGGG - Intergenic
1000433410 5:161179309-161179331 GACGGAGAGCACAGTGATGGTGG + Intergenic
1000539413 5:162521196-162521218 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1000568190 5:162877864-162877886 TAAGGAAATTACATTGACTGGGG - Intergenic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1001408661 5:171495126-171495148 GAAGGAAAGGACAGAGTTGGTGG - Intergenic
1003900791 6:10653630-10653652 GATGGAAAATACAGTATTTGTGG - Intergenic
1004574010 6:16875113-16875135 AAAGGAAAGTCCAATGATTATGG - Intergenic
1005102079 6:22182120-22182142 GAAGGAAACAACAGACATTGGGG - Intergenic
1005178003 6:23070100-23070122 GAAGGAAACAACAGACATTGGGG - Intergenic
1005246141 6:23887438-23887460 GAAGGAAAGCACAATGACTGGGG + Intergenic
1006204212 6:32325870-32325892 GGAGGAAACTTCAGTGGTTGTGG + Intronic
1006438278 6:34038158-34038180 GATGGAAAGAGCAGTGACTGAGG + Intronic
1007570401 6:42886052-42886074 GACAGACAATACAGTGATTGAGG + Exonic
1007617840 6:43192436-43192458 CAAGGCAAGTACACTGCTTGAGG + Intronic
1008333069 6:50265672-50265694 AAAGGAAAGTACAATCATTATGG + Intergenic
1008848684 6:55997715-55997737 GAGGGAGAGTGCAGTGTTTGTGG - Intergenic
1009041695 6:58187610-58187632 GAAGTTAAGTACATTGATCGTGG - Intergenic
1009057429 6:58353855-58353877 AAATGAAAGTTCAGTGTTTGAGG + Intergenic
1009728138 6:67560548-67560570 GAGGGAGAGCAAAGTGATTGTGG - Intergenic
1009781673 6:68279681-68279703 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1009823749 6:68839900-68839922 GAGGGAGAGCACAGTGATTGTGG + Intronic
1010062273 6:71636479-71636501 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1011454066 6:87527882-87527904 GAAGGAAAGAACACAGACTGGGG + Intronic
1011890152 6:92148665-92148687 GAAGGAAAGGACTGAGAATGAGG - Intergenic
1012047723 6:94300402-94300424 AAGGGAAAGTGCAGTTATTGTGG + Intergenic
1012059770 6:94463421-94463443 GAAGGAAAGCTCAGTGATTGTGG - Intergenic
1012345585 6:98181378-98181400 GAAGGAAATAACAGACATTGGGG + Intergenic
1012744440 6:103066855-103066877 GAAGGATAGTACAGTGTTCTTGG + Intergenic
1012824238 6:104126822-104126844 GAGGGAGATTGCAGTGATTGTGG - Intergenic
1012892004 6:104907576-104907598 GAAGGAAAGCACAGTGATTGTGG + Intergenic
1013908449 6:115245935-115245957 GAGGAAGAGTACAGCGATTGTGG + Intergenic
1014378650 6:120711155-120711177 GACGGAGAGTCCACTGATTGTGG + Intergenic
1015071171 6:129095010-129095032 GAAGCACATTACAGTGATTTTGG + Intronic
1015360253 6:132331778-132331800 GTAGGAAAGTACAGACTTTGGGG - Intronic
1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG + Intronic
1015911151 6:138168828-138168850 GAAGGAAAATACAGGGAATTAGG - Intronic
1016457464 6:144245763-144245785 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1017198618 6:151729004-151729026 AAAGGAGAGCACAGTGGTTGTGG - Intronic
1017289075 6:152713793-152713815 GAAACAAAGGACAGAGATTGTGG - Intronic
1018012668 6:159685873-159685895 CAAAGATAGTACAGTGAGTGGGG - Intronic
1019981793 7:4627096-4627118 GCAGGAATGTACAGTAACTGTGG - Intergenic
1020485506 7:8715231-8715253 GAGGGAGAGTGTAGTGATTGTGG - Intronic
1020717803 7:11698740-11698762 GAAAGGAAGTACAGAGATTAGGG + Intronic
1021214741 7:17901610-17901632 GAGGGAGAGCACAGTGATTATGG - Intronic
1021503858 7:21359092-21359114 GAAGCAAAGTGAAGTTATTGGGG + Intergenic
1021817712 7:24464384-24464406 GAAGTAAGGTACAGAGATTGAGG + Intergenic
1022034252 7:26518881-26518903 GAGGGAGGGTACAGTGATTGTGG + Intergenic
1022236372 7:28465611-28465633 GAGGGAAAGTAAAATGACTGAGG - Intronic
1022542095 7:31146834-31146856 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1022826152 7:34016339-34016361 GAAAGAAAGTAAAGGGATTATGG - Intronic
1022922984 7:35035253-35035275 GAAAGGAGGTACAGTGAATGTGG - Intronic
1023646162 7:42318270-42318292 GAGGGAGAGTGCAGTGGTTGTGG + Intergenic
1024490891 7:49984856-49984878 GAAGGAAAGGACATTATTTGAGG - Intronic
1024800413 7:53071354-53071376 GTAGGACAGTCCTGTGATTGAGG - Intergenic
1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG + Intronic
1025936073 7:66038485-66038507 GAATGAAAATACAGTATTTGAGG - Intergenic
1025973649 7:66352311-66352333 GGAGGGAATTACAGTGAATGGGG + Intronic
1026206118 7:68259051-68259073 GGAGAAAAGTACAGTTCTTGAGG + Intergenic
1026311459 7:69188952-69188974 GTAGTATGGTACAGTGATTGAGG - Intergenic
1027523954 7:79244450-79244472 GAGGGAGAGTGCAGTGATTGTGG + Intronic
1027747182 7:82091424-82091446 GCAGGAAACTAAAGTGATAGGGG - Intronic
1027889737 7:83956542-83956564 GAAGGAAGGTAAAGAGATTGTGG + Exonic
1028087876 7:86658526-86658548 GAAGGAAAATACAGAGAGTTTGG - Intronic
1028368718 7:90066148-90066170 GAAGTAAAGTGCAATGATTTGGG + Intergenic
1028669781 7:93388023-93388045 GGAGGAAAGTACAGAGAGTAGGG - Intergenic
1028929665 7:96398415-96398437 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1028972467 7:96874791-96874813 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
1029310674 7:99660577-99660599 GAAGGAAAGAACACTGCTGGTGG + Exonic
1030370905 7:108698085-108698107 GTAGGAAAGGACAGGGATTTGGG - Intergenic
1031215327 7:118883094-118883116 GAGGGAGAGCACAGTGATCGGGG + Intergenic
1031243858 7:119281648-119281670 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1031272163 7:119665714-119665736 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1031382157 7:121100136-121100158 GAAGTAAAGTAAAGTGAGTTGGG + Intronic
1031721808 7:125186644-125186666 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1031732540 7:125316383-125316405 GAGGGAGAGTACAGAGATTTTGG + Intergenic
1031862197 7:126993673-126993695 GAGGGAGAGCACAGTGACTGGGG + Intronic
1032186056 7:129727557-129727579 GAAGGAAAATACTGTGATAATGG + Intronic
1033502515 7:141966089-141966111 GAAGGAGAGTGCAGTGATTGAGG - Intronic
1033814121 7:145051649-145051671 GAGAGAAAGCACGGTGATTGTGG - Intergenic
1033877774 7:145843226-145843248 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1034126285 7:148674825-148674847 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1034878216 7:154743886-154743908 TATGGAAAGTACAGTATTTGAGG - Intronic
1034917252 7:155050921-155050943 GAAGCAAAGTACATTCTTTGAGG - Intergenic
1035421877 7:158736283-158736305 GTATGAAAGTACAATGAATGAGG + Intronic
1037163383 8:15798508-15798530 GAAGGATAGTACAGAGAAAGAGG + Intergenic
1038285919 8:26206498-26206520 ATAGGAAAGTACAGTGACTGTGG - Intergenic
1039177703 8:34827775-34827797 TAAGGAAAGTATTGTGATCGAGG - Intergenic
1041914044 8:63121713-63121735 GAAGGAAACAACAGACATTGGGG - Intergenic
1043214884 8:77573651-77573673 GAAGGAGAGCAAAGTGATTGTGG + Intergenic
1043549911 8:81359657-81359679 AAAGGAAAGTACAATGATGATGG + Intergenic
1043567202 8:81561638-81561660 GAAGGAGGGCACGGTGATTGTGG + Intergenic
1044241342 8:89892458-89892480 GAGGAAGAGTGCAGTGATTGTGG + Intergenic
1044358575 8:91255507-91255529 GCAGGAAGATACAGTGATTAAGG - Intronic
1044465113 8:92493461-92493483 GATGGAAAGTACAGTGGTAAGGG + Intergenic
1044497328 8:92902384-92902406 GAGGGAGAGTGCAGTGATTGTGG - Intronic
1044758140 8:95488577-95488599 GAAGGAAATAAAAGGGATTGAGG + Intergenic
1045168560 8:99636591-99636613 GTTGGAAAGTACAGGGATTTTGG + Intronic
1045321725 8:101086757-101086779 CAAGGAAACAACTGTGATTGAGG + Intergenic
1045733542 8:105268288-105268310 GCGGGACAGTACAGTGGTTGAGG - Intronic
1046811543 8:118538559-118538581 GAGGGAGAGCACAGTGATTGTGG - Intronic
1048118672 8:131554818-131554840 GAGGGAGAGCACAGTGACTGTGG + Intergenic
1048338647 8:133522230-133522252 GAAGGAAAGTTCAGAGGATGTGG + Intronic
1048456480 8:134583157-134583179 AAAGGTAAGTGCAGTGATGGAGG - Intronic
1048873754 8:138820526-138820548 GAAGGAAAGAACATTGATTCAGG + Intronic
1049135542 8:140894775-140894797 GATGGAAAGTACAGGAATGGAGG + Intronic
1049964442 9:765720-765742 GAAAGAAAGTAAAGTGCTTTGGG - Intergenic
1050238933 9:3613635-3613657 GAGGGAAAGTGCAGGGATTGTGG - Intergenic
1050618729 9:7430183-7430205 GAGACAGAGTACAGTGATTGTGG - Intergenic
1050907013 9:11016894-11016916 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1051039220 9:12785666-12785688 GAGGGAGAATACAGTGATTATGG - Intronic
1051306617 9:15717180-15717202 AAGGGAGAGCACAGTGATTGTGG + Intronic
1051651811 9:19333982-19334004 AATGGAAAGCATAGTGATTGGGG + Intronic
1052093880 9:24361732-24361754 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1052411557 9:28128268-28128290 GATGGAAAGAGCACTGATTGAGG - Intronic
1054784331 9:69196293-69196315 GAAGTAAAGTAAGTTGATTGAGG - Intronic
1055283555 9:74702811-74702833 GAAGGAGAGTGAAGTGAGTGTGG + Intergenic
1055778489 9:79793135-79793157 GATGAAAAGAACAGTGATTTGGG - Intergenic
1055906412 9:81299455-81299477 AATGAAAAGTACACTGATTGGGG + Intergenic
1056129885 9:83574002-83574024 GAAGGAATGTATACTTATTGGGG - Intergenic
1056230694 9:84539729-84539751 GAGGGAGAACACAGTGATTGTGG - Intergenic
1056516664 9:87358798-87358820 GAGAGAAAGTGCAGTGACTGTGG + Intergenic
1057241227 9:93411777-93411799 GAGAGAAAGTGCAGTGATTGTGG - Intergenic
1059555601 9:115277132-115277154 AAGGGAGAGTGCAGTGATTGTGG - Intronic
1059838967 9:118191199-118191221 AAGAGAGAGTACAGTGATTGTGG + Intergenic
1059886565 9:118751079-118751101 GAGGGACAGCACAGTGATTGTGG + Intergenic
1060070735 9:120544789-120544811 CCAGGAAGGTACAGTGATGGAGG - Intronic
1060437353 9:123605430-123605452 GAATGAAAGGACAGTCACTGTGG + Intronic
1060651397 9:125330015-125330037 GGAGGAAAGTGCAGTGATAGTGG - Intronic
1060684495 9:125596319-125596341 GGAGGAAACTTCAGTGGTTGTGG + Intronic
1185755847 X:2652308-2652330 GAAGGAGACTACAGTGTTTGGGG + Intergenic
1185963986 X:4578661-4578683 GAAGGAATCTACAGGAATTGGGG + Intergenic
1186850689 X:13576674-13576696 GAAGGGGAGAACAGAGATTGAGG + Intronic
1186980988 X:14957247-14957269 GCAGCACAGTACAGTGAATGTGG - Intergenic
1187549570 X:20288511-20288533 GAAGGAAAATGGAGTGTTTGTGG + Intergenic
1187723891 X:22182389-22182411 GAAGGAGAGTACGGTGATTGTGG - Intronic
1188117785 X:26266352-26266374 GCAGAAGAGTACAGTGACTGAGG + Intergenic
1188716549 X:33465466-33465488 GAAAGAGAGCACAATGATTGTGG - Intergenic
1188972405 X:36633563-36633585 GAGGGAGAGCACAGTGATTATGG - Intergenic
1189412004 X:40780597-40780619 GAAGGAGAGCACAGTGATGGTGG - Intergenic
1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG + Intergenic
1189640649 X:43067448-43067470 GAAGGAAAGTGTAGTGATTGTGG + Intergenic
1189737039 X:44082154-44082176 GAAGGAAAAAATAGTGATAGAGG - Intergenic
1190140714 X:47841181-47841203 GACAGACAGTACAGTGATTGAGG - Intronic
1190498450 X:51051565-51051587 GAAAGAGAGTAAAGTGATTATGG + Intergenic
1190521507 X:51282851-51282873 GAAAGAGAGTAGAGAGATTGTGG + Intergenic
1190956987 X:55205281-55205303 GAAGGAAAGTAGAATGTTTTTGG - Intronic
1191179058 X:57540119-57540141 GAAAGTGAGTGCAGTGATTGTGG + Intergenic
1191603548 X:63037169-63037191 GAAGGAAACAACAGTTACTGGGG - Intergenic
1192259636 X:69497031-69497053 GGATGAAAGTACAGTGGTTCAGG - Intergenic
1192374755 X:70548602-70548624 AAGGGAGAGCACAGTGATTGTGG + Intronic
1192793301 X:74405734-74405756 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
1192875349 X:75223646-75223668 GAGGGAAACTGCAGTGATTGTGG - Intergenic
1192890814 X:75389051-75389073 GAGGGAGAGTGCAGTGACTGTGG + Intronic
1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG + Intronic
1193896934 X:87126495-87126517 GAGGGAGAGTGCAGTGATTATGG + Intergenic
1194254231 X:91616722-91616744 AGTGGAAAGTACAGTGATTTAGG - Intergenic
1194507669 X:94752668-94752690 AGGGGAAAGTAAAGTGATTGTGG - Intergenic
1194526368 X:94982842-94982864 GTGGGAAAGTGCAGTGACTGTGG + Intergenic
1194842078 X:98754822-98754844 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1195290156 X:103424429-103424451 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1195477440 X:105303043-105303065 GGAGGAGAGTGCAGTGATTGTGG - Intronic
1195543436 X:106088250-106088272 GAAGGAAAGCACAGCAATTGTGG - Intergenic
1195595330 X:106682704-106682726 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1195601224 X:106751276-106751298 GAAGGAGAGCACAGTGATTGTGG + Intronic
1195842327 X:109187824-109187846 AAAGGAAAGTAAAGTAAATGAGG - Intergenic
1195917110 X:109947088-109947110 GAAAGAAAGAACACTGACTGTGG + Intergenic
1196217703 X:113072669-113072691 GAGGGAGAGCTCAGTGATTGTGG - Intergenic
1196234601 X:113263326-113263348 GAAGAAAAGCACAGTGATTGTGG - Intergenic
1196368741 X:114951973-114951995 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG + Intergenic
1197110861 X:122772766-122772788 GAAGAAATGTATAGGGATTGGGG + Intergenic
1197177964 X:123504779-123504801 GAGGGAGAGCACAGTGATTTGGG + Intergenic
1197399870 X:125977355-125977377 GAGGGAAAGCAAAGTGATTGTGG + Intergenic
1197439219 X:126470280-126470302 GAGGGAAAGCATAGTGATTGTGG + Intergenic
1197468489 X:126837188-126837210 AAAGGAAAGCACAGTGATTGGGG + Intergenic
1197495393 X:127173368-127173390 CAAGGAAGCTACAGTGATTAAGG - Intergenic
1197514698 X:127411271-127411293 GAGAGACAGCACAGTGATTGTGG - Intergenic
1197623651 X:128779836-128779858 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1197670703 X:129273799-129273821 GAGGGAAAGCACAGTGATTGTGG - Intergenic
1197755949 X:129994969-129994991 GAAGCAAAGTAAAGTGTTTGGGG + Intronic
1198136170 X:133752681-133752703 GAAGGGAAGTTCTGTGAGTGAGG - Intronic
1198697363 X:139355766-139355788 GGAGAAAAGCACAGTGATTGTGG - Intergenic
1198714407 X:139541168-139541190 GAAGGAAAGAACTGTGAATTAGG + Exonic
1198724531 X:139663631-139663653 GAAGGAAACAACAGACATTGGGG - Intronic
1199325090 X:146489932-146489954 GAGGGAGAGTACAGTGACTGAGG + Intergenic
1199393176 X:147305731-147305753 GAAGGACAGTGCAGTGACTTGGG + Intergenic
1199457510 X:148045031-148045053 GAGGGAGAGCACAGTGGTTGTGG - Intergenic
1199464452 X:148120314-148120336 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1199795395 X:151191063-151191085 GAGGGAGAGCAAAGTGATTGCGG + Intergenic
1199916494 X:152347342-152347364 GAAGGATAGTGGAGTGGTTGAGG + Intronic
1200573020 Y:4856301-4856323 AGTGGAAAGTACAGTGATTTAGG - Intergenic
1201887990 Y:18907498-18907520 GAAGGAATCTACAGGAATTGGGG + Intergenic
1202111134 Y:21421821-21421843 GAAGGAGAGCACAGAGACTGAGG - Intergenic
1202386713 Y:24333469-24333491 GGAGAAAAGGACAGTGAATGGGG - Intergenic
1202484072 Y:25336659-25336681 GGAGAAAAGGACAGTGAATGGGG + Intergenic