ID: 1015392788

View in Genome Browser
Species Human (GRCh38)
Location 6:132701848-132701870
Sequence AAGGAAAGTACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015392773_1015392788 30 Left 1015392773 6:132701795-132701817 CCCATCCTCCAGGTTACCACATG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392778_1015392788 22 Left 1015392778 6:132701803-132701825 CCAGGTTACCACATGGTGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392779_1015392788 14 Left 1015392779 6:132701811-132701833 CCACATGGTGTGGAGAGAAAATT 0: 1
1: 1
2: 10
3: 38
4: 255
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392776_1015392788 25 Left 1015392776 6:132701800-132701822 CCTCCAGGTTACCACATGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data
1015392774_1015392788 29 Left 1015392774 6:132701796-132701818 CCATCCTCCAGGTTACCACATGG 0: 1
1: 1
2: 1
3: 37
4: 282
Right 1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015392788 Original CRISPR AAGGAAAGTACAGTGATTGT GGG Intronic
No off target data available for this crispr