ID: 1015395492

View in Genome Browser
Species Human (GRCh38)
Location 6:132729494-132729516
Sequence GTGGATCCACTAAGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015395492 Original CRISPR GTGGATCCACTAAGGCAGAA AGG (reversed) Intronic
901172127 1:7266800-7266822 GTGGATGCCCTAAGGCTGGAAGG + Intronic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
904954237 1:34269691-34269713 GTCTATAAACTAAGGCAGAAGGG + Intergenic
905724070 1:40233568-40233590 GTGGAGCCACTAAAGCAACATGG + Intronic
907297017 1:53461693-53461715 GAGGATCCATCAAGGCAGCAGGG - Intronic
907388245 1:54139712-54139734 GTGGGTCCACTGAGGGCGAAGGG - Exonic
908201846 1:61805647-61805669 ATTGATCCACTAGGGAAGAAAGG - Intronic
909585094 1:77281124-77281146 GTGGGTGCGCTAAGGCATAATGG - Intergenic
915365828 1:155315202-155315224 GTGGATCCACTACAGCACACAGG + Intronic
916407860 1:164515282-164515304 CTGGATGCACTAAGTCAGCAGGG - Intergenic
916506508 1:165433067-165433089 GTGCATCCTCTGATGCAGAAGGG - Intronic
916506514 1:165433118-165433140 GTGCATCCTCTGATGCAGAAGGG - Intronic
920542429 1:206789379-206789401 ATGGATTCACAAAGGCATAAGGG - Intergenic
924621984 1:245669937-245669959 GAGGGTCCACAAAGGCAGAGTGG + Intronic
1068578327 10:58709600-58709622 GTGGAACCACTAATACAGATGGG + Intronic
1070897479 10:79996865-79996887 TGGGATCCACCAAGGCAGCAAGG - Intergenic
1074831424 10:117252356-117252378 ATGAATCCAGGAAGGCAGAAGGG - Intronic
1090147472 11:124340920-124340942 GTACATCCCCTAAGGCAGAGTGG + Intergenic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1096091565 12:48905282-48905304 GTGGGTCCTCTAAGGGAGAGAGG - Intronic
1097089128 12:56491609-56491631 ATGGAGAAACTAAGGCAGAAAGG - Intergenic
1099872096 12:88362202-88362224 GTGGTTAAACTAAGGCAGAGTGG + Intergenic
1099997785 12:89797355-89797377 GATGATCCACCAAGGCAGAAAGG - Intergenic
1101133972 12:101720238-101720260 ATGGATCCACTATAGCAGTAAGG + Exonic
1103047806 12:117752463-117752485 GTGGTTCCAATAATGAAGAAAGG + Intronic
1105032919 12:132897140-132897162 GAGGATCCACAGAGGAAGAAGGG - Intronic
1110898115 13:80782798-80782820 GTTGACCCACTAAAGCAGATGGG - Intergenic
1113022220 13:105900087-105900109 GGGGATCAAATAAGCCAGAACGG - Intergenic
1115734798 14:36313985-36314007 ATGTATGCACTATGGCAGAAAGG + Intronic
1121526596 14:94623688-94623710 TTGTCTCCACTAATGCAGAAAGG - Exonic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125305729 15:38310525-38310547 GTGGATCAACTTGGGGAGAATGG + Intronic
1129689593 15:77705712-77705734 CTGGATCCTCTCAGGCACAATGG + Intronic
1131762580 15:95640521-95640543 GAGAATCCACTAGGGAAGAAAGG - Intergenic
1136315828 16:29454321-29454343 GTGGCTCCTGTAAGGCAGCAAGG - Exonic
1136430405 16:30193663-30193685 GTGGCTCCTGTAAGGCAGCAAGG - Exonic
1138126872 16:54446519-54446541 GGGGGTCGACTGAGGCAGAAGGG - Intergenic
1140155282 16:72418514-72418536 TTGGATCTGCTAAGGGAGAAAGG + Intergenic
1141130249 16:81431606-81431628 GTGAAACCACTCAGGCAGAGGGG + Intergenic
1143692883 17:8585508-8585530 GTGGATCCTCAAAGGCACCATGG + Intronic
1144693918 17:17288365-17288387 ATGGATACACTATGGCAAAAGGG - Intergenic
1160210093 18:76870728-76870750 GTGGGTCCCCTAAGGCTGCAGGG - Intronic
1160428018 18:78791621-78791643 CTGGTTCCACTGAGGCACAAAGG + Intergenic
1161742949 19:6035338-6035360 GAGGTTCCACTTGGGCAGAAAGG + Intronic
1163952633 19:20604423-20604445 GTAGATTCATTAAGTCAGAATGG - Intronic
1164875643 19:31684840-31684862 TTGGAATCACTAAGGGAGAAAGG - Intergenic
1167426046 19:49430259-49430281 TTGAAACCACTGAGGCAGAACGG + Exonic
928241383 2:29589875-29589897 GTGGAAGCACTTTGGCAGAAAGG + Intronic
929496114 2:42445661-42445683 GTGCATGCAGTAATGCAGAAAGG - Intronic
929998703 2:46846771-46846793 GTGGATGAACTCAGGCAGAGGGG + Intronic
932126466 2:69149478-69149500 GTAGATGAACTAAAGCAGAAGGG - Intronic
937839727 2:126513124-126513146 CTGGCTCCAGGAAGGCAGAATGG + Intergenic
943727242 2:191265215-191265237 TGGGATACACTATGGCAGAATGG - Intronic
944990221 2:205226910-205226932 GTGGATCAATTAAGAAAGAATGG - Intronic
1169806808 20:9568055-9568077 GTGTGTCCACTAAGGAAGATGGG + Intronic
1170341903 20:15338405-15338427 GTGGTTCCGCTATGGCAGCAGGG - Intronic
1175852792 20:62102811-62102833 GAGCTTCCACTCAGGCAGAAGGG - Intergenic
1177850696 21:26344123-26344145 CTTGATTCACTAAAGCAGAAAGG - Intergenic
1178862908 21:36304282-36304304 GAGGATCGATTAAGGCAGAGAGG - Intergenic
1180608993 22:17083936-17083958 GTGGATGCACTAGGGCAGGACGG + Intergenic
1181840881 22:25659467-25659489 GTGTAACCACCAAAGCAGAAAGG + Intronic
1182792022 22:32960844-32960866 GTAGAGCCACTGAGGCAAAAGGG - Intronic
949188451 3:1221511-1221533 ATGTACCCTCTAAGGCAGAAAGG + Intronic
949683585 3:6542686-6542708 TCAGATCCACTAATGCAGAATGG - Intergenic
949963349 3:9333509-9333531 GTGTATCAGGTAAGGCAGAAAGG - Intronic
953881869 3:46694920-46694942 GTGGAGCCCCTCAGGCAGCAGGG - Intergenic
958169934 3:89926720-89926742 GTGGAGAAACGAAGGCAGAAAGG - Intergenic
976333338 4:83856971-83856993 GGGGCTCCAGTAAGGCAGCAGGG - Intergenic
979452918 4:120893327-120893349 GGGGATCCATCAAGGCAGCAGGG - Intronic
985716169 5:1463203-1463225 GTGGATCCACAGAGGCAGACAGG + Exonic
986492762 5:8308750-8308772 GATGTTCCCCTAAGGCAGAAGGG - Intergenic
990948538 5:61274304-61274326 GTGATTCCACAAAGGCAGCAAGG - Intergenic
991573263 5:68077442-68077464 GTGGATTCTCAAAGGCTGAATGG + Intergenic
996595345 5:125195281-125195303 GTTGATCAACTCAGGAAGAAAGG + Intergenic
998057360 5:139089751-139089773 GTAGATCCATAAAGACAGAAAGG + Intronic
999001577 5:147929478-147929500 GTGGATCCCCAAAGATAGAAAGG + Intergenic
1000939675 5:167345285-167345307 GTGCAACCACTAAAGCCGAATGG - Intronic
1001787789 5:174428381-174428403 CTAGATCTGCTAAGGCAGAAAGG - Intergenic
1002831749 6:828345-828367 GTGCATCAACCAAGGCATAATGG + Intergenic
1004059213 6:12175766-12175788 GTGCATTCACTAAGGGAGGATGG + Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1007961836 6:45967216-45967238 GTGGATCCACACAGCCAGATGGG + Intronic
1010878389 6:81137982-81138004 GGGGATCCATTAAGGCAGCAGGG + Intergenic
1013289017 6:108705015-108705037 GGGGATCACCGAAGGCAGAAAGG - Intergenic
1015395492 6:132729494-132729516 GTGGATCCACTAAGGCAGAAAGG - Intronic
1019821477 7:3246427-3246449 GTGGCTCCTTTAAGGCAGAAAGG - Intergenic
1023195668 7:37636049-37636071 GTGGAAAGACTAAGGCAGAGTGG - Intergenic
1027516372 7:79147390-79147412 GAGGATCCACTACGGCCCAAGGG - Intronic
1028481757 7:91313988-91314010 GTGGTTCCCCAAAGGCAGAATGG - Intergenic
1034588869 7:152121594-152121616 GTGGATCCCCTGGGTCAGAAGGG + Exonic
1041220839 8:55649234-55649256 TGGGATCCATCAAGGCAGAAGGG - Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1046222651 8:111236147-111236169 CTGGATCACCTAAGGCAGAGAGG - Intergenic
1051334962 9:16057803-16057825 CTGGATCCACTCAGGCACAGTGG + Intronic
1053027827 9:34745252-34745274 GTGGATCCAAGAAGCCAGTATGG - Intergenic
1055792039 9:79932991-79933013 GTGGGTCCACTAAGGAACAAAGG - Intergenic
1058968480 9:110058615-110058637 GTGGATCCACGCAGGCAGGGAGG - Intronic
1059662545 9:116416246-116416268 GTGAATGCAATAAGGCAGGAGGG + Intergenic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1189915712 X:45853515-45853537 GTAGATTCAGTAAGGCAGAAAGG - Intergenic
1192940178 X:75903679-75903701 ATCCATCTACTAAGGCAGAAAGG - Intergenic
1193847334 X:86490253-86490275 GTTGACCCAATAAGGCAAAAAGG - Intronic
1196085904 X:111681818-111681840 GTTGATCAAGTGAGGCAGAACGG + Intronic
1196208299 X:112966467-112966489 GTGAATCAACTAAGGTAAAAGGG + Intergenic
1198162058 X:134017735-134017757 TTGGAGCCACTAGGGTAGAAAGG + Intergenic
1201072990 Y:10166197-10166219 GTGGAACCAAGAGGGCAGAAAGG - Intergenic