ID: 1015400039

View in Genome Browser
Species Human (GRCh38)
Location 6:132778302-132778324
Sequence TCCATAAGGTACCCAATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015400039_1015400043 22 Left 1015400039 6:132778302-132778324 CCTGACATTGGGTACCTTATGGA 0: 1
1: 0
2: 0
3: 10
4: 319
Right 1015400043 6:132778347-132778369 TTATAATACTCTCTAAATCTTGG 0: 1
1: 0
2: 1
3: 21
4: 285
1015400039_1015400042 -6 Left 1015400039 6:132778302-132778324 CCTGACATTGGGTACCTTATGGA 0: 1
1: 0
2: 0
3: 10
4: 319
Right 1015400042 6:132778319-132778341 TATGGATACTCACTGGCTAAAGG 0: 1
1: 0
2: 2
3: 1
4: 90
1015400039_1015400044 28 Left 1015400039 6:132778302-132778324 CCTGACATTGGGTACCTTATGGA 0: 1
1: 0
2: 0
3: 10
4: 319
Right 1015400044 6:132778353-132778375 TACTCTCTAAATCTTGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015400039 Original CRISPR TCCATAAGGTACCCAATGTC AGG (reversed) Intronic
900859668 1:5219153-5219175 TCCATAAATTACCCACTCTCAGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904337558 1:29808013-29808035 TCCATTAGATACCCAGTGACAGG - Intergenic
907862871 1:58370918-58370940 TTCATAAATTACCCAATCTCAGG + Intronic
909619814 1:77654781-77654803 TCCACAAATTACCCAATTTCTGG - Intronic
909690587 1:78403117-78403139 TTCATAAACTACCCAATCTCAGG - Intronic
910805899 1:91189737-91189759 TTCATAAGTTACCCAGTCTCAGG - Intergenic
911483376 1:98473814-98473836 TTCATAAAGTACCCATTATCAGG + Intergenic
913403849 1:118465757-118465779 TTCATAAATTACCCAATCTCAGG + Intergenic
917205255 1:172564618-172564640 TTCATAAATTACCCAATCTCAGG + Intronic
918194447 1:182208288-182208310 TTCAGAAGGTAGCCAATCTCTGG - Intergenic
918564427 1:185911366-185911388 TTCATAAGGTTTCCAATGCCTGG + Intronic
918789484 1:188808159-188808181 TTCATAAGTTACCCAGTCTCAGG - Intergenic
919416154 1:197312983-197313005 TTCATAAGTTACCCAGTCTCAGG - Intronic
919986197 1:202677148-202677170 TTCATAAGTTACCCAGTCTCAGG + Intronic
921790798 1:219288030-219288052 TCCATAAATTACCCAGTCTCAGG + Intergenic
922367668 1:224881233-224881255 TCCATAAATTACCCAGTCTCAGG - Intergenic
922926164 1:229348305-229348327 TAAATAAGTTACCCAATTTCTGG + Intergenic
923889291 1:238194372-238194394 TCCACAGGATACCCAATGCCAGG - Intergenic
923941720 1:238833935-238833957 TTCATAAATTACCCAATCTCAGG + Intergenic
1062772161 10:110863-110885 TTCATAAATTACCCAATCTCAGG - Intergenic
1063896625 10:10689127-10689149 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1064422988 10:15206210-15206232 TCCCTGAGGTACCCAATGGAAGG + Intergenic
1064585433 10:16834821-16834843 GCCCTAAGGTTCCCAATTTCCGG + Intronic
1064723293 10:18251620-18251642 TTCATAAGTTACCCAGTCTCAGG - Intronic
1067287680 10:44918974-44918996 TCTATAAGGTACCCAGTATATGG + Intronic
1068062170 10:52081968-52081990 TTTATAAGTTACCCAATCTCAGG - Intronic
1068305137 10:55198964-55198986 TTCATAAATTACCCAATCTCAGG + Intronic
1068600101 10:58947597-58947619 TCTATAAGGTATCAAATGGCTGG - Intergenic
1068623494 10:59212255-59212277 TGTATAAGTTACCCAGTGTCAGG + Intronic
1069342083 10:67422822-67422844 TTCATAAGTTACCCAGTCTCAGG + Intronic
1071964421 10:90837628-90837650 TTCATAAGCTACCCAATCTGTGG + Intronic
1072202268 10:93171150-93171172 TTCATAAATTACCCAATCTCAGG - Intergenic
1072391030 10:94987213-94987235 TTCATAAATTACCCAATCTCAGG - Intronic
1073887447 10:108056474-108056496 TTTATAAAGTACCCAATCTCAGG - Intergenic
1075535901 10:123271910-123271932 TACATAAATTACCCAGTGTCAGG + Intergenic
1075851037 10:125587155-125587177 TTCATAAATTACCCAATTTCAGG + Intronic
1076229719 10:128809944-128809966 TTTATAAGTTACCCAATTTCAGG + Intergenic
1077400081 11:2350948-2350970 TCTATAAAGTACCCAGTTTCAGG - Intergenic
1079127681 11:17730510-17730532 TCCATAAAGGGACCAATGTCTGG - Intergenic
1079433694 11:20422967-20422989 TACATAAGCTACACAATCTCTGG - Intronic
1079503055 11:21124482-21124504 TTTATAAGCTACCCAGTGTCAGG - Intronic
1079558290 11:21789290-21789312 TTCATAAATTACCCAATATCAGG + Intergenic
1079581606 11:22071428-22071450 TTCATAAATTACCCAGTGTCAGG - Intergenic
1079904100 11:26223624-26223646 TTCATAAATTACCCAATCTCAGG - Intergenic
1080332396 11:31154250-31154272 TTCATAAATTACCCAGTGTCAGG + Intronic
1082919553 11:58478203-58478225 TCCATAAATTACCCAGTCTCAGG + Intergenic
1083349188 11:62015161-62015183 CCAAGAAGGTAGCCAATGTCAGG - Intergenic
1083435367 11:62639353-62639375 TCCATGAGGTCACCAAGGTCAGG - Exonic
1083620507 11:64047118-64047140 TTCATGAGGCAGCCAATGTCGGG - Intronic
1085935205 11:81133448-81133470 TCCAGAAGTTACTAAATGTCAGG - Intergenic
1087085019 11:94209104-94209126 TCCATATTGTAACCAATGTTAGG - Intergenic
1087168721 11:95028790-95028812 TCTATAAATTACCCAATTTCAGG + Intergenic
1088212468 11:107472083-107472105 ATCATAAGGTACATAATGTCTGG - Intergenic
1088554392 11:111047313-111047335 TTTATAAAGTACCCAATTTCAGG - Intergenic
1091053166 11:132393213-132393235 TCTATAAGCTACCCAGTGTTTGG + Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1093208830 12:16283336-16283358 TCCATAAATTACCCAGTCTCAGG + Intergenic
1093301797 12:17467810-17467832 TTTATAAGCTACCCAATGTATGG + Intergenic
1093558955 12:20514900-20514922 TTTATAAGTTACCCAGTGTCAGG - Intronic
1094382503 12:29858000-29858022 TTCATAAATTACCCAATCTCAGG + Intergenic
1094797008 12:33986062-33986084 TTTATAAGTTACCCAATCTCAGG + Intergenic
1095163392 12:38942188-38942210 TGCCTAAGGTTTCCAATGTCAGG + Intergenic
1097137516 12:56871197-56871219 TCCACAAGGTACCCATTTGCGGG - Intergenic
1097652660 12:62320443-62320465 TTCATAAGTTACCCAGTCTCAGG + Intronic
1099076145 12:78112403-78112425 TTCATAAAGTACCCAATTTGGGG - Intronic
1099308997 12:80994553-80994575 TTCATAAATTACCCAATCTCAGG - Intronic
1101635662 12:106539427-106539449 TCTATAAGTTACCCAGTCTCAGG - Intronic
1102191373 12:110991183-110991205 TTCATAAATTACCCAATCTCAGG + Intergenic
1102788974 12:115628110-115628132 TTTATAAGTTACCCAATCTCGGG - Intergenic
1104535788 12:129616773-129616795 TTCATAAAGTACCCAGTCTCGGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1108178648 13:47819683-47819705 TCCATAAGTTACCCAGTTTCAGG + Intergenic
1109130290 13:58575820-58575842 TTCATAAATTACCCAATCTCAGG - Intergenic
1109242154 13:59902484-59902506 TTCATAAATTACCCAGTGTCAGG + Intronic
1111567800 13:90039378-90039400 TTCATAAATTACCCAGTGTCAGG + Intergenic
1112313283 13:98339156-98339178 TACATAAATTACCCAATCTCAGG - Intronic
1112360252 13:98710866-98710888 TCCATAAGGTACTCAGTGACTGG - Intronic
1112574408 13:100622684-100622706 TCTATAAATTACCCAGTGTCAGG + Intronic
1112930705 13:104732668-104732690 TCTATAAGTTACCCAGTTTCAGG + Intergenic
1113089927 13:106606634-106606656 TTCATAAGCTACCCAGTCTCAGG + Intergenic
1113253338 13:108479238-108479260 TTCATAAATTACCCAATCTCAGG - Intergenic
1113257376 13:108521671-108521693 TACTTAAGGTCCCAAATGTCAGG - Intergenic
1114244590 14:20900843-20900865 TTTATAAGTTACCCAATCTCAGG - Intergenic
1114247580 14:20928986-20929008 TTTATAAGTTACCCAATCTCAGG - Intergenic
1116046943 14:39755085-39755107 TTCATAAATTACCCAATCTCAGG - Intergenic
1116497732 14:45582883-45582905 TTCCTAAGGTACCCAATCCCAGG - Intergenic
1117234649 14:53758742-53758764 TTCATAAGGAAAACAATGTCAGG + Intergenic
1120960492 14:90120395-90120417 TTTATAAGTTACCCAATCTCGGG - Intronic
1124693928 15:31847719-31847741 TTCATAAGTTACCCAGTCTCAGG - Intronic
1125394861 15:39235753-39235775 TTCATAAAGTACCCAGTCTCAGG + Intergenic
1126197562 15:45949212-45949234 TTCATAAGTTACCCAGTCTCAGG + Intergenic
1126420246 15:48464901-48464923 TCAATAAGGTTGCCATTGTCTGG + Intronic
1126462304 15:48927022-48927044 TCCTTAAGGTACCCAAGGCTTGG - Intronic
1130978572 15:88796137-88796159 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1131975095 15:97936376-97936398 TCCATAAGGTAACCTCTGTTAGG - Intergenic
1133486200 16:6221619-6221641 TTCATAAATTACCCATTGTCAGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134374141 16:13654403-13654425 TCCATAAATTACCCAGTCTCAGG + Intergenic
1140051742 16:71487444-71487466 TCCATAAATTACCCAGTCTCAGG + Intronic
1140573604 16:76137830-76137852 TCTATAAGTTACCCAGTCTCAGG - Intergenic
1141879786 16:86850189-86850211 TCCATAAGGTTAACAATCTCTGG - Intergenic
1142687462 17:1585973-1585995 TCCATGATGTAGCCAATGACGGG + Exonic
1149047192 17:52260786-52260808 TTTATAAATTACCCAATGTCAGG - Intergenic
1149072086 17:52555512-52555534 TCTATAAGTTACCCATTCTCAGG + Intergenic
1151230389 17:72680631-72680653 TCTATAAATTACCCAATGTCAGG + Intronic
1151902404 17:77025306-77025328 TTCATAAATTACCCAGTGTCAGG - Intergenic
1157088482 18:44607076-44607098 TCCAGAAGGCTCCCAATGTTGGG - Intergenic
1157758904 18:50244472-50244494 TAAATAAGTTACCCAATATCAGG + Intronic
1158591152 18:58780061-58780083 TTCATAAATTACCCAGTGTCAGG - Intergenic
1159185537 18:64967577-64967599 TCTATAAATTACCCAATCTCAGG - Intergenic
1159468223 18:68813324-68813346 TTCATAAGTTACCCAGTCTCAGG + Intronic
1161827535 19:6578713-6578735 TCCATATTGTCCCAAATGTCAGG - Intergenic
1165636410 19:37343963-37343985 TCCATAAGCTTCCCAAGGACTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167974835 19:53216866-53216888 TTCATAAATTACCCAATATCAGG + Intergenic
1168559276 19:57369849-57369871 TTCATAAAGTACCCAGTCTCAGG - Intronic
925570791 2:5310495-5310517 TCTATAAGCTACCCACTCTCCGG + Intergenic
925948951 2:8893209-8893231 TCGATAATGTATCCAATGTGGGG + Intronic
926442216 2:12901771-12901793 TCCATAAGGTCCACATTGTGAGG + Intergenic
926819082 2:16833200-16833222 TTCATAAGTTACCCAGTCTCAGG + Intergenic
927062920 2:19441084-19441106 TCCATAAATTACCCAGTCTCAGG - Intergenic
928797653 2:35041309-35041331 TTCATAAGTTACCCAGTCTCAGG + Intergenic
928893922 2:36239606-36239628 TTCATAAATTACCCAGTGTCAGG - Intergenic
929314975 2:40466086-40466108 TCTATAAGTTACCCAGTATCAGG + Intronic
930247711 2:49002427-49002449 TTTATAAGTTACCCAATCTCAGG - Intronic
930452547 2:51560443-51560465 TTCATAAATTACCCAATCTCAGG - Intergenic
931041317 2:58304364-58304386 TCTATAAGTTACCCAGTCTCCGG + Intergenic
931297681 2:60945043-60945065 TTCATCAGGGACCCAATGTTTGG + Exonic
932502584 2:72196925-72196947 TGCATATGGTACTCAATGCCTGG - Intronic
932866757 2:75351681-75351703 TCCATAAATTACCCAGTCTCAGG - Intergenic
933333974 2:80930641-80930663 TTCATAAATTACCCAATCTCAGG - Intergenic
935305984 2:101736795-101736817 TCCACCAGGTACCAAGTGTCAGG - Intronic
936257178 2:110926987-110927009 TTCATAAATTACCCAATCTCAGG - Intronic
936787956 2:116118336-116118358 TCCATAAATTACCCACTCTCAGG - Intergenic
937515862 2:122654579-122654601 TCCATAAATTACCCAACCTCAGG + Intergenic
940610268 2:155981212-155981234 TCCATAAATTACCCAGTCTCAGG - Intergenic
941734192 2:168955300-168955322 TTCATAAATTACCCAGTGTCAGG - Intronic
942111320 2:172685155-172685177 TGCATAAATTACCCAATCTCAGG + Intergenic
943470132 2:188284602-188284624 TTCATAAATTACCCAGTGTCAGG + Intergenic
943879901 2:193130534-193130556 TCCATAAATTACCCAGTCTCAGG - Intergenic
943978682 2:194517171-194517193 GCCATTGGGTACCCAATGTTAGG - Intergenic
944546241 2:200801769-200801791 TTCATAAATTACCCAATCTCAGG + Intergenic
944693233 2:202177408-202177430 TTCATAAATTACCCAATCTCAGG - Intronic
946644278 2:221816467-221816489 TTCATAAATTACCCAATCTCTGG + Intergenic
947247057 2:228060699-228060721 TCCATAAGGCATCTAATGTTGGG + Intronic
948773341 2:240263972-240263994 TTCATAAGTTACCCAGTCTCAGG + Intergenic
1168746421 20:246470-246492 TTTATAAAGTACCCAATTTCAGG - Intergenic
1168904838 20:1394805-1394827 TCCATAAATTACCCAGTCTCAGG - Intergenic
1170444507 20:16412049-16412071 TCCTTCAGGTGCCCAATGTTAGG - Intronic
1174323188 20:49758664-49758686 ACCACAAGGTACCCAGCGTCTGG - Intergenic
1174545229 20:51320056-51320078 TTCATAAGTTACCCAGTCTCGGG - Intergenic
1176991463 21:15502211-15502233 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1177212487 21:18087829-18087851 TCCATAAACTACCCAGTCTCAGG - Intronic
1177561127 21:22755696-22755718 TTCATAAATTACCCAGTGTCGGG - Intergenic
1178667753 21:34563986-34564008 TTTATAAACTACCCAATGTCGGG - Intronic
1183438201 22:37807633-37807655 TCCAGAGGGTACCCCATTTCCGG + Intergenic
1185132774 22:49049349-49049371 TCCATAAATTACCCAGTCTCGGG - Intergenic
949127802 3:467622-467644 TCCATAAATTACCCAGTCTCAGG - Intergenic
949521236 3:4855961-4855983 TCTATAAAGTACCCAGTCTCAGG + Intronic
950931202 3:16790653-16790675 TCCATAAATTACCCAGTCTCAGG + Intergenic
951257439 3:20466868-20466890 TTCATAAATTACCCAATGTGTGG - Intergenic
952042007 3:29272158-29272180 TCCATAAATTACCCAGTCTCTGG - Intergenic
952226997 3:31387460-31387482 TTCATAAATTACCCAGTGTCAGG + Intergenic
952346072 3:32487018-32487040 TTTATAAGTTACCCAGTGTCAGG + Intronic
953380523 3:42468049-42468071 TTCATAAATTACCCAATCTCAGG + Intergenic
953552463 3:43914205-43914227 TCCATAAATTACCCAGTCTCAGG + Intergenic
954300999 3:49700736-49700758 TCCAGAGGGCACCCCATGTCTGG - Intronic
955586122 3:60480019-60480041 TTCATAAAGTACCCAGTCTCTGG - Intronic
956945355 3:74215571-74215593 TCTATAAATTACCCAGTGTCAGG + Intergenic
957193151 3:77037333-77037355 TCCATAAGGTAGCTAGTGTATGG + Intronic
957674550 3:83349835-83349857 TCCAAATTGTACCCATTGTCAGG + Intergenic
957716856 3:83939094-83939116 TTTATAAAGTACCCAATATCAGG + Intergenic
958754416 3:98233791-98233813 TTCATAAAGTACCCAGTCTCAGG + Intergenic
959171216 3:102846950-102846972 TCCATAAATTACCAAATCTCAGG - Intergenic
959900870 3:111660988-111661010 TCCATAAATTACCCAGTTTCAGG - Intronic
960492544 3:118334315-118334337 TTCATAAATTACCCAATCTCAGG + Intergenic
962473572 3:135736111-135736133 TTCATAAATTACCCAATCTCAGG + Intergenic
962969130 3:140382644-140382666 TCTATAAGCTACCCAGTGTGTGG - Intronic
963571554 3:147003675-147003697 TCTATAAATTACCCAATATCAGG - Intergenic
964184102 3:153922090-153922112 TCCAGAAAATACCAAATGTCTGG + Intergenic
964509160 3:157431291-157431313 TCCATAAATTACCCAGTCTCAGG + Intronic
965387057 3:168057385-168057407 TTCATAAGTTACCCAGTCTCAGG - Intronic
965781811 3:172294283-172294305 TTCATAAATTACCCAATCTCAGG - Intronic
966315460 3:178640220-178640242 TTCACAAATTACCCAATGTCAGG - Intronic
966491051 3:180529239-180529261 TCCATAAATTACCCAGTCTCAGG - Intergenic
966823656 3:183945166-183945188 TTCATAAATTACCCAATCTCAGG + Intronic
966972689 3:185060083-185060105 TTCATAAAGTACCCAGTCTCAGG + Intergenic
969163051 4:5278705-5278727 TCCATAAATTACCCAGTCTCAGG - Intronic
969684237 4:8660861-8660883 TTCATAAGTTACCCAGTCTCAGG + Intergenic
970063700 4:12066918-12066940 TCTATAAGTTATCAAATGTCAGG - Intergenic
970121501 4:12758219-12758241 TTCATAAATTACCCAATCTCAGG - Intergenic
970459153 4:16255629-16255651 TTCATAAGTTACCCAGTCTCAGG - Intergenic
971576988 4:28287049-28287071 TTTATAAAGTACCCAGTGTCGGG + Intergenic
972010065 4:34167938-34167960 TTTATAAGCTACCCAATCTCGGG - Intergenic
972684554 4:41339280-41339302 TTTATAAGTTACCCAATCTCAGG - Intergenic
973976081 4:56263946-56263968 TCCATAAATTACCCAGTCTCAGG - Intronic
974197258 4:58591733-58591755 TCCATAAACTACCCAGTCTCAGG - Intergenic
974257949 4:59486531-59486553 TCTATAAAGAACCCAATGTCAGG + Intergenic
975230113 4:71923269-71923291 TCCATAAATTACCCAGTCTCTGG + Intergenic
975637538 4:76464911-76464933 TTCATAAATTACCCAATCTCAGG + Intronic
975706311 4:77115424-77115446 TTCATAAATTACCAAATGTCAGG - Intergenic
976599450 4:86924830-86924852 TAAATAAGTTACCCAATCTCAGG - Intronic
977466531 4:97389382-97389404 TCCATAATTTGCCCAATCTCAGG - Intronic
978219166 4:106248848-106248870 TTTATAAGTTACCCAATATCAGG + Intronic
978294385 4:107186596-107186618 TTCATAAATTACCCAATCTCAGG + Intronic
979060740 4:116058130-116058152 TTCATAAGTTACCCAGTCTCAGG - Intergenic
979182746 4:117752319-117752341 TGTATAAATTACCCAATGTCAGG + Intergenic
980449413 4:132950497-132950519 CCCATAAAGTACCCAGTCTCTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
981959864 4:150523508-150523530 TTCATAAGTTACCCAATCTCAGG + Intronic
982322619 4:154095203-154095225 TTTATAAGTTACCCAATCTCAGG + Intergenic
983443752 4:167821750-167821772 TCTATAAATTACCCAATCTCCGG + Intergenic
983822360 4:172211667-172211689 TTCATAAATTACCCAATGTAAGG - Intronic
984013349 4:174398458-174398480 TTCATAAGTTACCCAGTCTCGGG + Intergenic
984184518 4:176527058-176527080 TCTATAAGGTAGGCAAAGTCTGG - Intergenic
986424301 5:7614918-7614940 TTCATAAGTTACCCAGTCTCAGG - Intronic
986660261 5:10053042-10053064 TCTATAAACTACCCAATCTCAGG - Intergenic
986999139 5:13641293-13641315 TCTATAAATTACCCAATCTCAGG + Intergenic
987986049 5:25147169-25147191 TTTATAAAGTACCCAATATCAGG + Intergenic
988628400 5:32901637-32901659 TTCATAAATTACCCAATCTCAGG - Intergenic
990921991 5:60978344-60978366 TCCATAAATTACCCAGTCTCAGG - Intronic
992157283 5:73967756-73967778 TTTATAAGTTACCCAGTGTCAGG + Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
994831003 5:104784181-104784203 TTTATAAGTTACCCAATTTCGGG - Intergenic
995399268 5:111721888-111721910 TTCATAAATTACCCAATCTCAGG + Intronic
995673617 5:114636377-114636399 TTCATAAATTACCCAGTGTCAGG - Intergenic
996232944 5:121088356-121088378 TTCATAAATTACCCAATTTCAGG - Intergenic
997531497 5:134584241-134584263 TTCATTAGGTCTCCAATGTCTGG - Intergenic
998072110 5:139206007-139206029 TTTATAAGTTACCCAATCTCAGG + Intronic
998938029 5:147251283-147251305 TCCCTGAGGTACTCAATATCTGG - Intronic
1000944681 5:167406301-167406323 TCCACAGGGTGCCTAATGTCAGG - Intronic
1001393827 5:171402924-171402946 TTCATAAATTACCCAATCTCAGG + Intronic
1001944059 5:175762626-175762648 TTTATAAGTTACCCAATCTCAGG + Intergenic
1003038261 6:2663543-2663565 TTCATAAATTACCCAATCTCAGG + Intergenic
1004286731 6:14328280-14328302 TTCATAAATTACCCAACGTCGGG - Intergenic
1004880530 6:20002924-20002946 TTCATAAGTTATCCAATCTCAGG + Intergenic
1005217143 6:23543627-23543649 TTCATAAAGTACCCAGTCTCAGG + Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006255852 6:32831475-32831497 TCCAAGAGGCACACAATGTCTGG - Intronic
1006723755 6:36180444-36180466 TTCATAAATTACCCAGTGTCAGG + Intergenic
1007105009 6:39277706-39277728 TCTATAAATTACCCAATTTCAGG + Intergenic
1007975396 6:46095958-46095980 TTTATAAATTACCCAATGTCAGG - Intergenic
1008048862 6:46879602-46879624 TTCATAAATTACCCAATCTCAGG + Intronic
1008252548 6:49258233-49258255 TTCATAAAGTACCCAGTGTAAGG - Intergenic
1008872368 6:56287670-56287692 TTCATAAGTTACCCAGTCTCAGG + Intronic
1009792266 6:68419154-68419176 TTCATAAAGTACCCAATCTTAGG + Intergenic
1010457530 6:76075551-76075573 TTCATAAATTACCCAATCTCAGG - Intergenic
1012031555 6:94073642-94073664 TCTCTAAGTTTCCCAATGTCAGG + Intergenic
1012256870 6:97043166-97043188 TATATAAGTTACCCAATGTCAGG + Intronic
1012493953 6:99813536-99813558 TCCATAAGTTACCAAGTCTCTGG + Intergenic
1012825146 6:104138565-104138587 TTCATAAATTACCCAGTGTCAGG - Intergenic
1012956783 6:105579669-105579691 TCCATAAATTACCCAGTCTCAGG - Intergenic
1013856007 6:114572732-114572754 TTCATAAATTACCCAATCTCAGG + Intergenic
1014415417 6:121177493-121177515 TTCATAAATTACCCAATCTCAGG + Intronic
1014472304 6:121831746-121831768 TTTATAAATTACCCAATGTCAGG - Intergenic
1015013293 6:128377194-128377216 TGCATAAATTACCCAACGTCAGG - Intronic
1015093731 6:129389582-129389604 TTCATAAGTTACCCAGTCTCAGG - Intronic
1015347403 6:132175863-132175885 TCCATAAATTACCCAGTCTCAGG - Intergenic
1015400039 6:132778302-132778324 TCCATAAGGTACCCAATGTCAGG - Intronic
1015615192 6:135067203-135067225 TTCATAAATTACCCAATCTCAGG + Intronic
1016666519 6:146648390-146648412 TCCATAAATTACCCAGTCTCAGG - Intronic
1016856866 6:148679336-148679358 TTTATAAATTACCCAATGTCAGG + Intergenic
1017593970 6:156008699-156008721 TTTATAAGTTACCCAATCTCAGG + Intergenic
1018507302 6:164485137-164485159 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1020403402 7:7803596-7803618 TTCATAAGGTATCCAATTTATGG - Intronic
1022249590 7:28593986-28594008 TCCGGAAGGAACCCAAAGTCAGG - Intronic
1023893781 7:44414923-44414945 TCCAAAAGGTACCCAAGGTGAGG + Intronic
1024171924 7:46797790-46797812 TCCATAAATTACCCAGTCTCAGG - Intergenic
1025006513 7:55359947-55359969 TTCATAAATTACCCAATCTCAGG - Intergenic
1027434427 7:78149810-78149832 TTCATCAGGTACCCAACATCTGG + Intronic
1027552869 7:79620571-79620593 TCCATAAAATACCCAGTCTCAGG + Intergenic
1028120394 7:87050578-87050600 TTTATAAAGTACCCAATCTCAGG + Intronic
1030381334 7:108814562-108814584 TTCATAAGTTACCCATTCTCAGG + Intergenic
1031717465 7:125126221-125126243 TTTATAAGTTACCCAATCTCAGG - Intergenic
1032311472 7:130791252-130791274 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1034542155 7:151765137-151765159 TGCATAAGTTACCCAGTTTCAGG - Intronic
1037755871 8:21709785-21709807 TCCTGAGGGTTCCCAATGTCAGG - Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038159704 8:25024967-25024989 TTCATAAATTACCCAATCTCAGG - Intergenic
1038333275 8:26626709-26626731 GCCTGAAGGTACCAAATGTCAGG - Intronic
1039128909 8:34238587-34238609 TCCATAAATTACCCAGTTTCAGG - Intergenic
1039155785 8:34554967-34554989 TTCATAAGCCACCCAATGTTTGG + Intergenic
1039378131 8:37057909-37057931 TTTATAAGTTACCCAATCTCAGG + Intergenic
1039739472 8:40368791-40368813 TTTATAAGTTACCCAATCTCAGG + Intergenic
1040365289 8:46709134-46709156 TTTATAAGTTACCCAGTGTCAGG + Intergenic
1041311997 8:56526488-56526510 TCTATAAATTACCCAATCTCAGG - Intergenic
1042165190 8:65938464-65938486 TTTATAAGTTACCCAATCTCAGG - Intergenic
1042200839 8:66278382-66278404 TTTATAAGTTACCCAATCTCAGG - Intergenic
1043211168 8:77520525-77520547 TCCATAAATTACCCAGTCTCAGG - Intergenic
1043958171 8:86386790-86386812 TCCATAAGTTACCTAGTCTCAGG - Intronic
1045314886 8:101034957-101034979 TCCATAAATTACCCAGTCTCAGG + Intergenic
1048781197 8:138003820-138003842 TCCATAAATTACCCAGTCTCAGG + Intergenic
1049303613 8:141885008-141885030 TCCATAAGGCACCGAAAGGCTGG - Intergenic
1051082421 9:13308831-13308853 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1051644505 9:19254423-19254445 TCCATAATGTCACCAATGACAGG - Intronic
1051951822 9:22644447-22644469 CACATAAGCTACCCAATGTATGG - Intergenic
1052303600 9:26980910-26980932 CCTATAAGTTACCCAATCTCAGG - Intronic
1053066643 9:35073736-35073758 TTCATAAGGTAGACGATGTCAGG + Intergenic
1054326085 9:63713213-63713235 CTCATAAGTTACCCAATATCAGG - Intergenic
1055852206 9:80645088-80645110 TTTATAAGTTACCCAATCTCGGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058050674 9:100403079-100403101 TTCATAAAGTACCCATTTTCAGG + Intergenic
1058522733 9:105828277-105828299 TTCTTAAGGTTCCCAATTTCAGG - Intergenic
1060820353 9:126658231-126658253 TACAAAGGGTACCAAATGTCAGG + Intronic
1203781579 EBV:103975-103997 TCCATAAGGTTCACATTGTTGGG - Intergenic
1185999806 X:4996066-4996088 TCCACAAAGTACCCAGTCTCTGG + Intergenic
1188887948 X:35573219-35573241 TCCATAAATTACCCAGTTTCGGG + Intergenic
1190015127 X:46820055-46820077 TCCTTAGGGTCCCCAATTTCAGG + Intergenic
1193121350 X:77825519-77825541 TTTATAAAGTACCCAATCTCAGG + Intergenic
1193516976 X:82478211-82478233 TCCACAATGTGACCAATGTCAGG + Intergenic
1194409691 X:93542912-93542934 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1194572688 X:95573134-95573156 TTCATAAGCTACCCAGTCTCAGG + Intergenic
1194609187 X:96019695-96019717 TTCATAAGTTACCCAGTCTCAGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1195460482 X:105117787-105117809 TTCATAAATTACCCAATCTCAGG + Intronic
1197651825 X:129073498-129073520 TTCATAAGTTACCCAGTGTGTGG + Intergenic
1198872976 X:141194929-141194951 TCTATAAATTACCCAATCTCAGG + Intergenic
1199239881 X:145534114-145534136 TTCATAAATTACCCAATCTCAGG + Intergenic
1199250672 X:145658557-145658579 TTCATAAAGTACCCAGTTTCAGG + Intergenic
1199420948 X:147644029-147644051 TTTATAAGTTACCCATTGTCTGG + Intergenic
1199463125 X:148105500-148105522 TTCATAAATTACCCAATCTCAGG + Intergenic
1199485338 X:148340548-148340570 TCCATAAATTACCCAGTCTCAGG + Intergenic
1199683491 X:150243689-150243711 TTCATAAGTTACCCAGTCTCAGG - Intergenic
1200050459 X:153427025-153427047 TTCATAAATTACCCAATCTCAGG + Intergenic
1200353615 X:155525437-155525459 TTCATAAAGTACCCAGTTTCAGG + Intronic
1201462107 Y:14238101-14238123 TTCATAAATTACCCAATCTCTGG - Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic