ID: 1015402272

View in Genome Browser
Species Human (GRCh38)
Location 6:132799866-132799888
Sequence CTGAGTTACCACTTTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015402271_1015402272 -5 Left 1015402271 6:132799848-132799870 CCAAAGCAAAACAAAAGACTGAG No data
Right 1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015402272 Original CRISPR CTGAGTTACCACTTTGTGCC AGG Intergenic
No off target data available for this crispr