ID: 1015403525

View in Genome Browser
Species Human (GRCh38)
Location 6:132813310-132813332
Sequence GCCAGCGCTGTGAATCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015403525_1015403531 16 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403531 6:132813349-132813371 ATAATTGCTCACTGGTTTGGCGG No data
1015403525_1015403532 29 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403532 6:132813362-132813384 GGTTTGGCGGCTGACTACCCAGG No data
1015403525_1015403528 8 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403528 6:132813341-132813363 AGCGCCTAATAATTGCTCACTGG No data
1015403525_1015403530 13 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403530 6:132813346-132813368 CTAATAATTGCTCACTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015403525 Original CRISPR GCCAGCGCTGTGAATCCAGT GGG (reversed) Intergenic
No off target data available for this crispr