ID: 1015403528

View in Genome Browser
Species Human (GRCh38)
Location 6:132813341-132813363
Sequence AGCGCCTAATAATTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015403526_1015403528 7 Left 1015403526 6:132813311-132813333 CCACTGGATTCACAGCGCTGGCA No data
Right 1015403528 6:132813341-132813363 AGCGCCTAATAATTGCTCACTGG No data
1015403522_1015403528 26 Left 1015403522 6:132813292-132813314 CCAGTCTAACAGTATCTGCCCAC No data
Right 1015403528 6:132813341-132813363 AGCGCCTAATAATTGCTCACTGG No data
1015403525_1015403528 8 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403528 6:132813341-132813363 AGCGCCTAATAATTGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015403528 Original CRISPR AGCGCCTAATAATTGCTCAC TGG Intergenic
No off target data available for this crispr