ID: 1015403530

View in Genome Browser
Species Human (GRCh38)
Location 6:132813346-132813368
Sequence CTAATAATTGCTCACTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015403525_1015403530 13 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403530 6:132813346-132813368 CTAATAATTGCTCACTGGTTTGG No data
1015403526_1015403530 12 Left 1015403526 6:132813311-132813333 CCACTGGATTCACAGCGCTGGCA No data
Right 1015403530 6:132813346-132813368 CTAATAATTGCTCACTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015403530 Original CRISPR CTAATAATTGCTCACTGGTT TGG Intergenic
No off target data available for this crispr