ID: 1015403532

View in Genome Browser
Species Human (GRCh38)
Location 6:132813362-132813384
Sequence GGTTTGGCGGCTGACTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015403529_1015403532 -6 Left 1015403529 6:132813345-132813367 CCTAATAATTGCTCACTGGTTTG No data
Right 1015403532 6:132813362-132813384 GGTTTGGCGGCTGACTACCCAGG No data
1015403526_1015403532 28 Left 1015403526 6:132813311-132813333 CCACTGGATTCACAGCGCTGGCA No data
Right 1015403532 6:132813362-132813384 GGTTTGGCGGCTGACTACCCAGG No data
1015403527_1015403532 1 Left 1015403527 6:132813338-132813360 CCAAGCGCCTAATAATTGCTCAC No data
Right 1015403532 6:132813362-132813384 GGTTTGGCGGCTGACTACCCAGG No data
1015403525_1015403532 29 Left 1015403525 6:132813310-132813332 CCCACTGGATTCACAGCGCTGGC No data
Right 1015403532 6:132813362-132813384 GGTTTGGCGGCTGACTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015403532 Original CRISPR GGTTTGGCGGCTGACTACCC AGG Intergenic
No off target data available for this crispr