ID: 1015407284

View in Genome Browser
Species Human (GRCh38)
Location 6:132852065-132852087
Sequence GAGGATCACCTGACTAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015407274_1015407284 10 Left 1015407274 6:132852032-132852054 CCTGTACTCCCAGCTACTCAGGT No data
Right 1015407284 6:132852065-132852087 GAGGATCACCTGACTAGGGGAGG No data
1015407278_1015407284 1 Left 1015407278 6:132852041-132852063 CCAGCTACTCAGGTGGCTGAGGT 0: 186
1: 14131
2: 117146
3: 221667
4: 238866
Right 1015407284 6:132852065-132852087 GAGGATCACCTGACTAGGGGAGG No data
1015407276_1015407284 2 Left 1015407276 6:132852040-132852062 CCCAGCTACTCAGGTGGCTGAGG 0: 1013
1: 100592
2: 206316
3: 240354
4: 152589
Right 1015407284 6:132852065-132852087 GAGGATCACCTGACTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015407284 Original CRISPR GAGGATCACCTGACTAGGGG AGG Intergenic
No off target data available for this crispr