ID: 1015408304

View in Genome Browser
Species Human (GRCh38)
Location 6:132862574-132862596
Sequence CTAAATTAGAAGTAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015408304_1015408307 25 Left 1015408304 6:132862574-132862596 CCTTGTTCCTACTTCTAATTTAG No data
Right 1015408307 6:132862622-132862644 TGCTTCCCCATATTTAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015408304 Original CRISPR CTAAATTAGAAGTAGGAACA AGG (reversed) Intergenic
No off target data available for this crispr