ID: 1015414262

View in Genome Browser
Species Human (GRCh38)
Location 6:132930881-132930903
Sequence CTGTCTGAGCAGCAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015414253_1015414262 3 Left 1015414253 6:132930855-132930877 CCACCAGGAGTGACCTGTGTACC No data
Right 1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG No data
1015414255_1015414262 -10 Left 1015414255 6:132930868-132930890 CCTGTGTACCCACCTGTCTGAGC No data
Right 1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG No data
1015414254_1015414262 0 Left 1015414254 6:132930858-132930880 CCAGGAGTGACCTGTGTACCCAC No data
Right 1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015414262 Original CRISPR CTGTCTGAGCAGCAGGAGGG AGG Intergenic
No off target data available for this crispr