ID: 1015415954

View in Genome Browser
Species Human (GRCh38)
Location 6:132948911-132948933
Sequence TGTTACCTAAAGCCCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015415951_1015415954 19 Left 1015415951 6:132948869-132948891 CCAGTCTGGGTGACAGAGCAAGA 0: 1119
1: 30050
2: 78920
3: 153122
4: 161955
Right 1015415954 6:132948911-132948933 TGTTACCTAAAGCCCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015415954 Original CRISPR TGTTACCTAAAGCCCTTGGG AGG Intergenic
No off target data available for this crispr