ID: 1015419768

View in Genome Browser
Species Human (GRCh38)
Location 6:132993634-132993656
Sequence GTACTTACCTTCAAGGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015419768_1015419775 5 Left 1015419768 6:132993634-132993656 CCGAACCCCTTGAAGGTAAGTAC No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015419768 Original CRISPR GTACTTACCTTCAAGGGGTT CGG (reversed) Intergenic
No off target data available for this crispr