ID: 1015419775

View in Genome Browser
Species Human (GRCh38)
Location 6:132993662-132993684
Sequence CTAGTTTATCTTTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015419767_1015419775 6 Left 1015419767 6:132993633-132993655 CCCGAACCCCTTGAAGGTAAGTA No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419772_1015419775 -1 Left 1015419772 6:132993640-132993662 CCCTTGAAGGTAAGTACCAGGGC No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419765_1015419775 21 Left 1015419765 6:132993618-132993640 CCATTAGAGTGTGGACCCGAACC No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419768_1015419775 5 Left 1015419768 6:132993634-132993656 CCGAACCCCTTGAAGGTAAGTAC No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419770_1015419775 0 Left 1015419770 6:132993639-132993661 CCCCTTGAAGGTAAGTACCAGGG No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419764_1015419775 22 Left 1015419764 6:132993617-132993639 CCCATTAGAGTGTGGACCCGAAC No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data
1015419773_1015419775 -2 Left 1015419773 6:132993641-132993663 CCTTGAAGGTAAGTACCAGGGCT No data
Right 1015419775 6:132993662-132993684 CTAGTTTATCTTTACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015419775 Original CRISPR CTAGTTTATCTTTACATTTT AGG Intergenic
No off target data available for this crispr