ID: 1015420009

View in Genome Browser
Species Human (GRCh38)
Location 6:132996865-132996887
Sequence GCTTAGCCAAAGGCTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015420009_1015420013 -8 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420013 6:132996880-132996902 GGCTAAGCTGAAATGAAAATGGG No data
1015420009_1015420019 18 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420019 6:132996906-132996928 AAGGAGACTAGGGTGTATGTGGG No data
1015420009_1015420016 7 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420016 6:132996895-132996917 AAAATGGGAGGAAGGAGACTAGG No data
1015420009_1015420015 -1 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420015 6:132996887-132996909 CTGAAATGAAAATGGGAGGAAGG No data
1015420009_1015420017 8 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420017 6:132996896-132996918 AAATGGGAGGAAGGAGACTAGGG No data
1015420009_1015420018 17 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420018 6:132996905-132996927 GAAGGAGACTAGGGTGTATGTGG No data
1015420009_1015420014 -5 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420014 6:132996883-132996905 TAAGCTGAAATGAAAATGGGAGG No data
1015420009_1015420020 27 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420020 6:132996915-132996937 AGGGTGTATGTGGGAAAGACCGG No data
1015420009_1015420012 -9 Left 1015420009 6:132996865-132996887 CCCAGGGGAGCCTTTGGCTAAGC No data
Right 1015420012 6:132996879-132996901 TGGCTAAGCTGAAATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015420009 Original CRISPR GCTTAGCCAAAGGCTCCCCT GGG (reversed) Intergenic
No off target data available for this crispr