ID: 1015421629

View in Genome Browser
Species Human (GRCh38)
Location 6:133017168-133017190
Sequence CATCAGAAGCCCAATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015421626_1015421629 19 Left 1015421626 6:133017126-133017148 CCAGAAGTAATTCGAGATGCTGG No data
Right 1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG No data
1015421625_1015421629 28 Left 1015421625 6:133017117-133017139 CCTGGGCAGCCAGAAGTAATTCG No data
Right 1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015421629 Original CRISPR CATCAGAAGCCCAATTAGGA AGG Intergenic
No off target data available for this crispr