ID: 1015426142

View in Genome Browser
Species Human (GRCh38)
Location 6:133070092-133070114
Sequence CATCTTCAGTGTGGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015426142_1015426151 30 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426151 6:133070145-133070167 GTGGTTGGACTCACACCTGCTGG No data
1015426142_1015426148 11 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426148 6:133070126-133070148 CACAGTTGAACCAGGGTAGGTGG No data
1015426142_1015426146 4 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG No data
1015426142_1015426149 15 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426149 6:133070130-133070152 GTTGAACCAGGGTAGGTGGTTGG No data
1015426142_1015426145 3 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426145 6:133070118-133070140 ACTCTCAACACAGTTGAACCAGG No data
1015426142_1015426147 8 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426147 6:133070123-133070145 CAACACAGTTGAACCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015426142 Original CRISPR CATCTTCAGTGTGGCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr