ID: 1015426144

View in Genome Browser
Species Human (GRCh38)
Location 6:133070101-133070123
Sequence GAGAGTGTGCATCTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015426144_1015426145 -6 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426145 6:133070118-133070140 ACTCTCAACACAGTTGAACCAGG No data
1015426144_1015426152 28 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426152 6:133070152-133070174 GACTCACACCTGCTGGTTCATGG No data
1015426144_1015426146 -5 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG No data
1015426144_1015426147 -1 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426147 6:133070123-133070145 CAACACAGTTGAACCAGGGTAGG No data
1015426144_1015426149 6 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426149 6:133070130-133070152 GTTGAACCAGGGTAGGTGGTTGG No data
1015426144_1015426151 21 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426151 6:133070145-133070167 GTGGTTGGACTCACACCTGCTGG No data
1015426144_1015426148 2 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426148 6:133070126-133070148 CACAGTTGAACCAGGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015426144 Original CRISPR GAGAGTGTGCATCTTCAGTG TGG (reversed) Intergenic
No off target data available for this crispr