ID: 1015426146

View in Genome Browser
Species Human (GRCh38)
Location 6:133070119-133070141
Sequence CTCTCAACACAGTTGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015426144_1015426146 -5 Left 1015426144 6:133070101-133070123 CCACACTGAAGATGCACACTCTC No data
Right 1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG No data
1015426142_1015426146 4 Left 1015426142 6:133070092-133070114 CCTGCCTGGCCACACTGAAGATG No data
Right 1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG No data
1015426143_1015426146 0 Left 1015426143 6:133070096-133070118 CCTGGCCACACTGAAGATGCACA No data
Right 1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015426146 Original CRISPR CTCTCAACACAGTTGAACCA GGG Intergenic
No off target data available for this crispr