ID: 1015434373

View in Genome Browser
Species Human (GRCh38)
Location 6:133168878-133168900
Sequence CTGATGAGGCTCATAATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015434373_1015434376 1 Left 1015434373 6:133168878-133168900 CCCTTAATTATGAGCCTCATCAG No data
Right 1015434376 6:133168902-133168924 CTTCAGAAAGTACCAATTTGAGG No data
1015434373_1015434378 16 Left 1015434373 6:133168878-133168900 CCCTTAATTATGAGCCTCATCAG No data
Right 1015434378 6:133168917-133168939 ATTTGAGGAGAGCCAGCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015434373 Original CRISPR CTGATGAGGCTCATAATTAA GGG (reversed) Intergenic