ID: 1015434375

View in Genome Browser
Species Human (GRCh38)
Location 6:133168892-133168914
Sequence GTACTTTCTGAAGTCTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015434375_1015434378 2 Left 1015434375 6:133168892-133168914 CCTCATCAGACTTCAGAAAGTAC No data
Right 1015434378 6:133168917-133168939 ATTTGAGGAGAGCCAGCCGTAGG No data
1015434375_1015434381 27 Left 1015434375 6:133168892-133168914 CCTCATCAGACTTCAGAAAGTAC No data
Right 1015434381 6:133168942-133168964 AAATTGTTGTCATTAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015434375 Original CRISPR GTACTTTCTGAAGTCTGATG AGG (reversed) Intergenic