ID: 1015434375 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:133168892-133168914 |
Sequence | GTACTTTCTGAAGTCTGATG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1015434375_1015434378 | 2 | Left | 1015434375 | 6:133168892-133168914 | CCTCATCAGACTTCAGAAAGTAC | No data | ||
Right | 1015434378 | 6:133168917-133168939 | ATTTGAGGAGAGCCAGCCGTAGG | No data | ||||
1015434375_1015434381 | 27 | Left | 1015434375 | 6:133168892-133168914 | CCTCATCAGACTTCAGAAAGTAC | No data | ||
Right | 1015434381 | 6:133168942-133168964 | AAATTGTTGTCATTAGAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1015434375 | Original CRISPR | GTACTTTCTGAAGTCTGATG AGG (reversed) | Intergenic | ||