ID: 1015434376

View in Genome Browser
Species Human (GRCh38)
Location 6:133168902-133168924
Sequence CTTCAGAAAGTACCAATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015434373_1015434376 1 Left 1015434373 6:133168878-133168900 CCCTTAATTATGAGCCTCATCAG No data
Right 1015434376 6:133168902-133168924 CTTCAGAAAGTACCAATTTGAGG No data
1015434374_1015434376 0 Left 1015434374 6:133168879-133168901 CCTTAATTATGAGCCTCATCAGA No data
Right 1015434376 6:133168902-133168924 CTTCAGAAAGTACCAATTTGAGG No data
1015434372_1015434376 13 Left 1015434372 6:133168866-133168888 CCACTATAGCTACCCTTAATTAT No data
Right 1015434376 6:133168902-133168924 CTTCAGAAAGTACCAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015434376 Original CRISPR CTTCAGAAAGTACCAATTTG AGG Intergenic