ID: 1015434462

View in Genome Browser
Species Human (GRCh38)
Location 6:133169647-133169669
Sequence ACAATTTGGTAGGAGAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015434462_1015434467 18 Left 1015434462 6:133169647-133169669 CCATGCCTCTCCTACCAAATTGT No data
Right 1015434467 6:133169688-133169710 TTAATATAATGTATATGGAAAGG No data
1015434462_1015434466 13 Left 1015434462 6:133169647-133169669 CCATGCCTCTCCTACCAAATTGT No data
Right 1015434466 6:133169683-133169705 TAACGTTAATATAATGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015434462 Original CRISPR ACAATTTGGTAGGAGAGGCA TGG (reversed) Intergenic
No off target data available for this crispr