ID: 1015435586

View in Genome Browser
Species Human (GRCh38)
Location 6:133182751-133182773
Sequence CAAAAGAAGGAAAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015435586_1015435590 -4 Left 1015435586 6:133182751-133182773 CCTGCCTTCTTTTCCTTCTTTTG No data
Right 1015435590 6:133182770-133182792 TTTGGCTTCATCTCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015435586 Original CRISPR CAAAAGAAGGAAAAGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr