ID: 1015437883

View in Genome Browser
Species Human (GRCh38)
Location 6:133210930-133210952
Sequence CAATTATTCCACAACTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015437881_1015437883 -6 Left 1015437881 6:133210913-133210935 CCTTCTCCTTTGTTCATCAATTA No data
Right 1015437883 6:133210930-133210952 CAATTATTCCACAACTTTACTGG No data
1015437880_1015437883 -5 Left 1015437880 6:133210912-133210934 CCCTTCTCCTTTGTTCATCAATT No data
Right 1015437883 6:133210930-133210952 CAATTATTCCACAACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015437883 Original CRISPR CAATTATTCCACAACTTTAC TGG Intergenic
No off target data available for this crispr