ID: 1015441966

View in Genome Browser
Species Human (GRCh38)
Location 6:133258902-133258924
Sequence AACCCTAGGGTCTTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015441962_1015441966 27 Left 1015441962 6:133258852-133258874 CCTTCAATTTTACTGAAGAATAA 0: 1
1: 0
2: 1
3: 55
4: 486
Right 1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 83
1015441961_1015441966 28 Left 1015441961 6:133258851-133258873 CCCTTCAATTTTACTGAAGAATA 0: 1
1: 0
2: 3
3: 35
4: 427
Right 1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 83
1015441960_1015441966 29 Left 1015441960 6:133258850-133258872 CCCCTTCAATTTTACTGAAGAAT 0: 1
1: 0
2: 1
3: 73
4: 517
Right 1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 83
1015441959_1015441966 30 Left 1015441959 6:133258849-133258871 CCCCCTTCAATTTTACTGAAGAA 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 83
1015441963_1015441966 -4 Left 1015441963 6:133258883-133258905 CCAACAAACAAGCAAACAGAACC 0: 1
1: 1
2: 7
3: 87
4: 597
Right 1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015441966 Original CRISPR AACCCTAGGGTCTTTCTCAA AGG Intronic
903408499 1:23119575-23119597 AAACCTAGGGTTTTTCAGAAGGG - Intronic
908548377 1:65185066-65185088 AACTCAAGGTTCTCTCTCAAGGG + Intronic
915306659 1:154983770-154983792 AAGACTAGGGTCTTCCTCGAAGG + Exonic
917347617 1:174044520-174044542 AACGCTGGGATCTTTCTGAAAGG - Intergenic
918248184 1:182679164-182679186 CACCCAAGGGTGTTTCCCAAGGG - Intronic
919093697 1:193004047-193004069 AACCCTAGGATTTTTCAGAATGG + Intergenic
920373296 1:205493003-205493025 AACCCCAGGCTCTTCCTCACTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1073107203 10:101039078-101039100 ACCCCTAGGGCCTATCTCCAAGG + Intronic
1073956340 10:108875708-108875730 AACTCTTGGGTCTTTCTTTAGGG - Intergenic
1074559624 10:114523475-114523497 AACCATAGGGTCTGACCCAAAGG - Intronic
1094630478 12:32168993-32169015 AAAGCAAGGGTTTTTCTCAATGG - Intronic
1101749989 12:107575729-107575751 ATCACAAGGGTCTTTATCAAAGG - Intronic
1108286902 13:48917768-48917790 ATCCCTAGGGTCCTTATCAGGGG - Intergenic
1116721968 14:48508717-48508739 AACCCTGGTCTCTTTCTGAAGGG - Intergenic
1124215965 15:27807248-27807270 AGCCATAGGGTCTTTCCCCAGGG + Intronic
1125104869 15:35958825-35958847 AACGCTGGGGTCTTGCTCAGGGG - Intergenic
1126488761 15:49213055-49213077 AGCCCTAGGGTATTTATCCAGGG - Intronic
1130194001 15:81762052-81762074 ATCCCTTGGGTTTTTCTCAGTGG + Intergenic
1131793466 15:95989629-95989651 AGCTCTAGGTTCTTACTCAAGGG - Intergenic
1132333250 15:101026891-101026913 ACCCCATGGGACTTTCTCAAGGG - Intronic
1133091085 16:3404187-3404209 AAAGCTTGGGCCTTTCTCAAGGG - Intronic
1136519625 16:30787124-30787146 GACTCTGGGGTCCTTCTCAAGGG + Exonic
1139204485 16:65013854-65013876 AACCCTAGGACCAGTCTCAAAGG + Intronic
1140052023 16:71489700-71489722 GACACAAGGGTCTTCCTCAATGG - Intronic
1140190453 16:72811535-72811557 CACCCTGTGGTCTTTCTCCAGGG - Intronic
1141389177 16:83650040-83650062 CACCCTTGGGGCTGTCTCAATGG - Intronic
1141838085 16:86555706-86555728 AATCCACGGGTGTTTCTCAAAGG - Intergenic
1151012959 17:70522312-70522334 CAACCTAGGGTCTTTTTCATTGG - Intergenic
1156951033 18:42898035-42898057 AACCCTAGCCTCTTTCTCTCTGG - Intronic
1164047842 19:21558055-21558077 CACCCTTGGTTCTTTCCCAAGGG - Intergenic
1167136400 19:47618764-47618786 ACCCCAAGGGTCTTTAGCAAGGG - Intronic
926531366 2:14050238-14050260 AACCCTAAGTTCTTTAGCAACGG + Intergenic
926863150 2:17330182-17330204 AACACTAGTGTCTGGCTCAAAGG - Intergenic
927200859 2:20577322-20577344 TAGCCTTGGGTCTTTCTGAAGGG - Intronic
927653577 2:24927271-24927293 AGCCCCACGGTCTTTCTCATGGG + Intergenic
928647434 2:33369460-33369482 AACCCTGGGGTCCTTCACAGGGG - Intronic
929280877 2:40076962-40076984 AACCCTAAAGGCTCTCTCAAAGG - Intergenic
929313441 2:40451434-40451456 ATCCCTGGGGTCTTTCCCCAAGG - Intronic
929434132 2:41914358-41914380 AACCCTAGTGTTTTTCTTCAAGG - Intergenic
933865083 2:86508830-86508852 AACCCTAGGGCCTTCCTGAATGG + Intronic
937302799 2:120853455-120853477 AGGCCCAGGGCCTTTCTCAAGGG - Intronic
937330461 2:121024118-121024140 ATCCCAAGGATCCTTCTCAAAGG + Intergenic
943476400 2:188362636-188362658 AACCCCAGGTTTTTTCACAAAGG + Intronic
948017661 2:234703138-234703160 AACACCAGCGTCTGTCTCAAAGG - Intergenic
1173184377 20:40829560-40829582 AACCCTAGAGCATCTCTCAAGGG + Intergenic
954569174 3:51626211-51626233 AACCAAAAGGTCTTTCCCAAAGG - Intronic
957698015 3:83668846-83668868 AAACCTACTGTCTTTGTCAATGG - Intergenic
962888585 3:139651601-139651623 AACCAAAGGGTGTATCTCAAAGG + Intronic
964428369 3:156577130-156577152 CAACATAGGGTATTTCTCAATGG + Intergenic
973775517 4:54237877-54237899 CACCATATGGTCTCTCTCAAGGG - Intronic
973777272 4:54255021-54255043 CACCATATGGTCTCTCTCAAGGG - Intronic
973786248 4:54335362-54335384 AACCTTAGGGTGTTTCTTGATGG + Intergenic
974385247 4:61196127-61196149 TACCCTGGGATATTTCTCAAAGG - Intergenic
981617111 4:146653830-146653852 AAGCCTATGGTTTTTCTCAATGG - Intergenic
986073748 5:4313179-4313201 AACCCTAAGGGCTTTATCATCGG + Intergenic
993567105 5:89489570-89489592 TACCCTAGGGTCTTTCCCTAGGG - Intergenic
995863433 5:116665012-116665034 AACACTCTGGCCTTTCTCAACGG - Intergenic
997697920 5:135875858-135875880 ACCACTAGGGTCTTGCTTAATGG - Intronic
997837297 5:137205894-137205916 AATGATAGGGTCTTTCTCATAGG - Intronic
997846383 5:137290091-137290113 AACCCTAGGATTTTACCCAATGG + Intronic
1006875342 6:37290560-37290582 AACCCCAGGGCCTTTCCCATGGG + Intronic
1007295604 6:40818511-40818533 AAGCCTAGGGTCTGAGTCAATGG + Intergenic
1008439363 6:51514941-51514963 AACCCTAGGGTCACTCTCTCTGG + Intergenic
1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG + Intronic
1017798477 6:157869653-157869675 AAGCCCAGGGTCTGTCTAAACGG + Intronic
1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG + Intronic
1022193640 7:28042293-28042315 AACTCTAAGGTCTTTCTGAATGG - Intronic
1028655738 7:93204731-93204753 AACCATATGGTCTTTCTAAAAGG - Intronic
1029408001 7:100389292-100389314 AACCCTTGCATCTTCCTCAATGG - Intronic
1030639519 7:111988291-111988313 AACCCTAGGGTCTCAGTCAAAGG + Intronic
1031886031 7:127246975-127246997 AGCACTGGGGTCTTTCTCCAAGG - Intronic
1036601369 8:10263675-10263697 ACACCTTGGGTCTTTCTGAAGGG + Intronic
1041064158 8:54065148-54065170 ATCCCTAGGGTATCTCTGAAGGG - Intronic
1042377186 8:68065142-68065164 AACCCAAGGTTCATTATCAAAGG + Intronic
1044055091 8:87558805-87558827 CACCATATGGTCTTTCACAATGG + Intronic
1047747437 8:127855428-127855450 AACCCTAGAGGGTTTCTCTAAGG - Intergenic
1049496247 8:142935133-142935155 AACCCTGGGGGCTTTCTCACAGG + Intergenic
1051761308 9:20468005-20468027 AACCTAAGGATCTTTCTCAAAGG - Intronic
1052358931 9:27533481-27533503 AACCCAAGGGGCTTTCCAAATGG - Intergenic
1055491124 9:76806390-76806412 AACCTTAGAGTCTTTCTGCACGG - Intronic
1055814317 9:80186278-80186300 AAACCTAGACTCTGTCTCAAAGG + Intergenic
1055998274 9:82185867-82185889 AACCCTTGGGACTTTCATAAGGG - Intergenic
1058545184 9:106053608-106053630 ATTCGTAGTGTCTTTCTCAAGGG - Intergenic
1058859483 9:109100934-109100956 AACCCAAGGGTCTTACTCAGTGG - Intronic
1062127799 9:134873498-134873520 ATCCCAAGGGTCCTTCTAAATGG - Intergenic
1185895000 X:3850210-3850232 AACCCTGGGATCTTGCACAAGGG + Intergenic
1185900118 X:3888635-3888657 AACCCTGGGATCTTGCACAAGGG + Intergenic
1185905234 X:3927063-3927085 AACCCTGGGATCTTGCACAAGGG + Intergenic
1187737842 X:22322652-22322674 ATCCTTTGGGGCTTTCTCAAGGG + Intergenic
1188015221 X:25100908-25100930 AACCCAAGTGTCTATCTCAGGGG - Intergenic
1189326513 X:40115200-40115222 AAACCTAGGCTCTTTCCCATAGG + Intronic
1194554986 X:95346348-95346370 AACTCTAGGGATTGTCTCAAGGG - Intergenic
1198817268 X:140605193-140605215 AACCCTAGGTATTTTATCAAAGG - Intergenic