ID: 1015443096

View in Genome Browser
Species Human (GRCh38)
Location 6:133271175-133271197
Sequence ATGCTGATTCAGAGCGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 3, 1: 72, 2: 96, 3: 98, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015443091_1015443096 19 Left 1015443091 6:133271133-133271155 CCCGTGAATCCTGGCTATGGGAG 0: 125
1: 202
2: 185
3: 155
4: 259
Right 1015443096 6:133271175-133271197 ATGCTGATTCAGAGCGTACATGG 0: 3
1: 72
2: 96
3: 98
4: 154
1015443093_1015443096 10 Left 1015443093 6:133271142-133271164 CCTGGCTATGGGAGAGACAGTGC 0: 1
1: 11
2: 170
3: 228
4: 312
Right 1015443096 6:133271175-133271197 ATGCTGATTCAGAGCGTACATGG 0: 3
1: 72
2: 96
3: 98
4: 154
1015443092_1015443096 18 Left 1015443092 6:133271134-133271156 CCGTGAATCCTGGCTATGGGAGA 0: 129
1: 151
2: 122
3: 124
4: 261
Right 1015443096 6:133271175-133271197 ATGCTGATTCAGAGCGTACATGG 0: 3
1: 72
2: 96
3: 98
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015443096 Original CRISPR ATGCTGATTCAGAGCGTACA TGG Intronic
901280813 1:8033323-8033345 AAGGTGATTCAGAGTGGACAGGG + Intergenic
903579887 1:24362872-24362894 ATGCAGATTCATAGCAAACAGGG - Intronic
906879848 1:49577868-49577890 ACTCTGATTCAGAGCATACACGG - Intronic
907597537 1:55733526-55733548 ATGCTGATTTAGAGCATACACGG - Intergenic
907780576 1:57562566-57562588 ATGCTGATTCAGAGCATACATGG - Intronic
908038482 1:60081812-60081834 ATGCTGATTCTGAGGCTAGAAGG + Intergenic
908052510 1:60248124-60248146 ACACTGATTCAGAGCATACATGG - Intergenic
908737590 1:67292225-67292247 ACACTGATTCAGAGCATACCCGG - Intergenic
909172410 1:72314055-72314077 ACGCTGATTCAGAGCATACGTGG + Intergenic
909577120 1:77187245-77187267 ATGCTGATTCAGAGCATACATGG - Intronic
909782993 1:79572694-79572716 ATGATGATTCAGATAGTACCTGG + Intergenic
910349733 1:86281642-86281664 ACACTGATTCAGAGTGTATACGG - Intergenic
910370833 1:86513564-86513586 ACGCTGATTCAGAACGTCCATGG - Intergenic
910562091 1:88601378-88601400 ATGCTGATTCGGAAGATACATGG - Intergenic
910588412 1:88903134-88903156 ATACTGATTCAGAGCACACACGG - Intergenic
910630406 1:89347676-89347698 ATGCTGATTCAGAGCATACACGG - Intergenic
910638684 1:89437535-89437557 GTGCTGATTCAGAGCGTAGATGG + Intergenic
910791624 1:91056728-91056750 ATGCTGATTCAGAGCATACATGG + Intergenic
910830901 1:91462011-91462033 GTGCTGATTCAGAGCATACACGG + Intergenic
910948406 1:92618122-92618144 ATGCTGATTCAGAGCATACATGG - Intronic
911108973 1:94163290-94163312 ATGCTGATTCAGAGCACACACGG + Intronic
911257142 1:95645943-95645965 ATGCCGATTCAGAGCATACATGG + Intergenic
911883765 1:103271876-103271898 ACGCTGATTCAGAACATACATGG - Intergenic
911980604 1:104560833-104560855 ACACTGAGTCAGAGCATACATGG - Intergenic
912050513 1:105523530-105523552 ATGCTAACTCAGACCATACATGG + Intergenic
912129724 1:106586642-106586664 ATTCTGATTCAGAACATACACGG + Intergenic
912212436 1:107570256-107570278 ACACTGATTCAGAGCATACACGG - Intergenic
912733131 1:112127417-112127439 ATGTTGATTCAGAGCATACACGG + Intergenic
915709847 1:157885051-157885073 ATGCTGATTCAGAGCATACAGGG - Intronic
916105998 1:161432884-161432906 ATGCTGATTTAGAGCATACATGG + Intergenic
916365908 1:164027469-164027491 ACACTGATTCAGAGCGTATATGG + Intergenic
917217027 1:172689494-172689516 ATGCTGATTCAGAGCATACATGG + Intergenic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
918768648 1:188523265-188523287 ATGCTGATTCAGAGCATACACGG - Intergenic
918774690 1:188612153-188612175 ATACTGAGTCAGAGCATACATGG - Intergenic
919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG + Intergenic
919230044 1:194762584-194762606 ATGCTGATTTAGAGCATATGCGG + Intergenic
920197627 1:204239771-204239793 ATGCTGATTCAGAACATACATGG - Intronic
921368403 1:214397138-214397160 TTACTGATCCAGAGAGTACATGG + Intronic
921477883 1:215632308-215632330 ATGCTGATGCAGATAGTTCATGG + Intronic
922292243 1:224217974-224217996 ATGCTGTTTCACAGTGTATAAGG - Intergenic
924840581 1:247706417-247706439 ACGCTGATTCAGAGCATACATGG + Intergenic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1064517396 10:16166371-16166393 ATGCTGATTCAGAGCATACATGG + Intergenic
1064559247 10:16579502-16579524 AAGCTGATTCAAAGCCCACATGG - Intergenic
1066169735 10:32828724-32828746 ATGCTGATTCAGAGAATACATGG - Intronic
1066180084 10:32953447-32953469 ATCCTGATGCAGAGCTGACAGGG + Intronic
1066331756 10:34431279-34431301 ATGCTGATTCAGAAAGTAGGGGG + Intronic
1066957816 10:42189468-42189490 GCGCTGATTCAGAGCACACATGG - Intergenic
1067754165 10:48992303-48992325 ACACTGATTCAGAGCATACATGG + Intergenic
1068007468 10:51408170-51408192 ATGCTGATTCAGAGTATACAAGG + Intronic
1068447390 10:57140002-57140024 ATGCTGATTCACAGCATACATGG - Intergenic
1068837027 10:61566966-61566988 ACACTGATTCAGAGCATACATGG + Intergenic
1069192123 10:65504966-65504988 ACACTGATTCAGAGCATACATGG + Intergenic
1069790637 10:71018170-71018192 ACGCTGATTCAGAGCATACATGG + Intergenic
1070653707 10:78256280-78256302 ATGCTGACTCATAGCTCACAAGG - Intergenic
1071266883 10:83972590-83972612 ACGATGATTCAGAGCATACACGG + Intergenic
1071937875 10:90550689-90550711 ATGCTGATTCAGAGCATATGTGG - Intergenic
1071942590 10:90606366-90606388 ATGCTGATTCAGAGCATACATGG + Intergenic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1073557551 10:104467307-104467329 ATGCTGATTCAGAGTATACATGG - Intergenic
1073656490 10:105423079-105423101 ATGCTGATTCAGAGCATACATGG + Intergenic
1074230222 10:111526322-111526344 ATTCTGATGCAGAGGGTAGAAGG + Intergenic
1074244012 10:111669592-111669614 ATGCTGATTCAGAGCATACCCGG + Intergenic
1074632351 10:115272672-115272694 ATGCTGACTCAGAGCTTATATGG + Intronic
1075078143 10:119365090-119365112 AGGCTGAGACAGAGCTTACAAGG + Intronic
1075606986 10:123818819-123818841 AGGCTGATTCAGAGCATACATGG - Intronic
1076441875 10:130485774-130485796 ATGCTGTTTCAGAGCTCCCATGG - Intergenic
1076772417 10:132673424-132673446 ACGCTGATTCAGAGCATCCATGG + Intronic
1078637263 11:13063532-13063554 ATTCAGATTCAGAACGTACTGGG - Intergenic
1081065275 11:38533356-38533378 ATGCTGATTCAGAGAATACATGG + Intergenic
1081609260 11:44549273-44549295 ATGCTGATTCAGAGCATACATGG - Intergenic
1081681510 11:45008900-45008922 ATGCTGATTCAGAGGATCTAGGG + Intergenic
1082671876 11:56044415-56044437 ATGCTGATTCTGAGCATACAGGG - Intergenic
1082794099 11:57367771-57367793 ATGCTGATTCTGTGGGTTCAGGG + Intronic
1085686152 11:78623575-78623597 ATGCTGATTCAGGGCATACACGG - Intergenic
1085748520 11:79136962-79136984 ATGCTGATTCAGAGCATACACGG - Intronic
1086141442 11:83504804-83504826 TTGCTGATTCAGAGCATACGTGG + Intronic
1088265618 11:107984990-107985012 ACACTGAATCAGAGCATACATGG - Intergenic
1089903807 11:122014997-122015019 ACACTGATTCGGAGCATACATGG - Intergenic
1092093817 12:5825338-5825360 ATGGTGATTCAGAGCATACATGG - Intronic
1093048740 12:14483696-14483718 ATGCTGATTCAGAGCATACACGG + Intronic
1093049483 12:14489594-14489616 ACGCTGATTCAGAGCATACATGG + Intronic
1093099488 12:15010681-15010703 CTGCTGAATCACAGCTTACAGGG - Intergenic
1094389595 12:29934833-29934855 ACGCTGATTCAGAGCATACATGG + Intergenic
1095374129 12:41505848-41505870 ATTCTGATTCAGTGGGTCCAGGG + Intronic
1095604089 12:44046034-44046056 ACGCTGATTCAGAACATACTTGG - Intronic
1095717972 12:45369262-45369284 ATGCTGACTCAGAGGCTAAAGGG + Intronic
1095856064 12:46862286-46862308 ACACTGCTTCAGAGCATACATGG + Intergenic
1096288963 12:50324640-50324662 ATGCTGATTCAGAGCATACATGG - Intergenic
1096457269 12:51798059-51798081 ACACTGATTCAAAGCATACATGG + Intronic
1097077192 12:56403785-56403807 ATGCTGATTCAGAGCGTACATGG - Intergenic
1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG + Intergenic
1097554774 12:61122992-61123014 ACACTGATTCAGAGCATACATGG - Intergenic
1097564458 12:61251059-61251081 ATGCTGATTCAGAGCATACACGG + Intergenic
1097843151 12:64341363-64341385 ATGCTGATTCAGAGCATACATGG + Intronic
1098716291 12:73831193-73831215 ATGCTGATTCAGAACATACAAGG - Intergenic
1099335624 12:81352966-81352988 ATTCTGATTCAGTGTGTACGGGG + Intronic
1099379202 12:81935159-81935181 ACGCTGATTCAGAGCATACACGG + Intergenic
1099526547 12:83724494-83724516 ATGCTGATTCAGAGCATACATGG - Intergenic
1100083494 12:90879595-90879617 ATGCTAATTCAGAGCATACATGG - Intergenic
1101534421 12:105604366-105604388 ATGCTGATTCAGAGCATAAATGG + Intergenic
1102443993 12:112987294-112987316 ATGCTTACTCAGAGCGTTGAAGG - Exonic
1102640654 12:114363539-114363561 ATGCTGATTAAGAGCTCACCAGG - Intronic
1103035822 12:117655464-117655486 ATGCCGATTCAGAGCATACACGG - Intronic
1103396724 12:120612833-120612855 ACACTGATTCAGAGCATACGTGG - Intergenic
1103743390 12:123106455-123106477 ATGCTGCATCAGAGCAAACAAGG + Intronic
1105335712 13:19466234-19466256 ATACTGATTCAGTGGGTCCAGGG + Intronic
1105740309 13:23316566-23316588 ACGCTGATTCAGAGCATACACGG - Intronic
1107983391 13:45754581-45754603 ATGTTGATGCAGAGCATACATGG + Intergenic
1108914123 13:55587505-55587527 ACGGTGATTCAGAGCATACATGG + Intergenic
1109950835 13:69500829-69500851 ACGCTGATTCAGAGCATGCATGG + Intergenic
1110345694 13:74445344-74445366 ATGGTGATCCAGATCCTACATGG + Intergenic
1111198719 13:84906274-84906296 ATGCTGATTCAGAGCATACACGG - Intergenic
1112249747 13:97768932-97768954 ACACTGATTCAGAGCATACATGG + Intergenic
1114758058 14:25282490-25282512 ACCCTGATTCAGAGTATACATGG + Intergenic
1115455779 14:33600826-33600848 ATGCTGTTTCAGAGTTTAGATGG - Intronic
1116158205 14:41235270-41235292 ACACAGATTCAGAGCATACACGG + Intergenic
1116415259 14:44670751-44670773 ATGCTGATTCAGAGCATACACGG - Intergenic
1117217038 14:53561548-53561570 ACCCTGATTCAGAGCATACATGG - Intergenic
1117596085 14:57328489-57328511 ATGCTGATTCAGAGCATATGGGG + Intergenic
1117634324 14:57725764-57725786 ACGCTGATTCAGAGTATACATGG - Intronic
1118122245 14:62858789-62858811 ATGCTGATTCAGAGCATACATGG + Intronic
1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG + Intergenic
1119059514 14:71460809-71460831 ACACTGATTCAGAGCATACATGG + Intronic
1119107359 14:71937453-71937475 ATGCTGATTCAGAGCATACACGG + Intronic
1120263916 14:82224868-82224890 ATGCAGAGTCACAGCGCACAAGG + Intergenic
1120555829 14:85929252-85929274 ATGCTGATTCAGAGCATTCATGG + Intergenic
1120594498 14:86417045-86417067 ATGCTGATTCAGAGCACACATGG + Intergenic
1120707406 14:87759097-87759119 ATGCTGATTCAGAGAAAACATGG + Intergenic
1120919886 14:89745096-89745118 AGGCTGATTCAGAGCATACACGG - Intergenic
1120973891 14:90232196-90232218 ACGCTGACTCAGAGCATACATGG - Intergenic
1121207905 14:92184729-92184751 ATGCTGATTTAGTCCTTACAGGG - Intergenic
1123128302 14:105965592-105965614 ATGCTGATTTGGAGCATACATGG - Intergenic
1202935292 14_KI270725v1_random:82308-82330 GCGCTGATTCAGAGCACACATGG + Intergenic
1123408827 15:20041749-20041771 ATGCTAATTTGGAGCATACATGG - Intergenic
1123518158 15:21048459-21048481 ATGCTAATTTGGAGCATACATGG - Intergenic
1126973614 15:54148833-54148855 AACCTGATTCAGAGCATGCAAGG - Intronic
1128691977 15:69731564-69731586 ATGCTGATACAGTCGGTACAGGG + Intergenic
1129595479 15:76960721-76960743 ATTCTGATTCAGATGGTCCAAGG + Intergenic
1129751472 15:78067809-78067831 ATGGTGATTCCCAGCTTACAGGG + Intronic
1130048129 15:80461707-80461729 ATGATGATGCAGAGCCTAGAAGG + Intronic
1132217792 15:100080017-100080039 ATGCTAATTCAGAACATATACGG - Intronic
1136251135 16:29005957-29005979 ATGCTGATTCAGAGCATATGTGG - Intergenic
1138868567 16:60852173-60852195 ATGCTGATTCAGAGCATACACGG - Intergenic
1139229818 16:65272881-65272903 ATGCTGATTCAGCTGGTCCAAGG - Intergenic
1139903023 16:70342915-70342937 ATGCTGATTCAGGAAGTACAGGG - Intronic
1141222880 16:82088144-82088166 ATTCTGATTCAGTGGGTCCAGGG + Intronic
1141559351 16:84856649-84856671 ATGCTGATTGAGGGCATACATGG + Intronic
1142774458 17:2125329-2125351 ATGATGATTCAGATACTACAAGG + Intronic
1146851125 17:36222407-36222429 ATGCTGATTCAGAGCATACATGG - Intronic
1148635500 17:49146118-49146140 ACACTGATTCAGAGCATACATGG + Intronic
1149255071 17:54816824-54816846 ACACTGATTCAGAGCATACATGG - Intergenic
1151037616 17:70820219-70820241 ATGCTGAGTCAGAGCATATAGGG + Intergenic
1153131083 18:1856336-1856358 ACACTGATTCAGAGCATCCAAGG + Intergenic
1154068658 18:11132471-11132493 ATGTTGATTCAGAGCATACACGG - Intronic
1154252369 18:12755373-12755395 ACGCTGATTCAGAGCATACACGG + Intergenic
1155584606 18:27350596-27350618 TTGCTGAGTCAGAGAGTAAAAGG - Intergenic
1156990124 18:43399397-43399419 ATGCTGATTCAGAGCATACATGG + Intergenic
1157341396 18:46781398-46781420 ATGCTGATTCAGAGTATATACGG - Intergenic
1157998316 18:52586738-52586760 ATGCTGATTCAGAGCATACATGG + Intronic
1159558914 18:69973977-69973999 ATGCTGATTCAGAGCACATACGG + Intergenic
1164760588 19:30725663-30725685 ATGCTTATTCAAAGCCAACATGG + Intergenic
1168539142 19:57196023-57196045 ATGCTAATTCAGAGCATACATGG + Intronic
925105362 2:1286315-1286337 ATGCTGATTCAGAGCATACATGG + Intronic
930794660 2:55376023-55376045 ATGTAGATTCTGAACGTACAAGG + Intronic
930910321 2:56622251-56622273 ATGCTGATTCAGAGCATACATGG - Intergenic
932199232 2:69811114-69811136 ATGCTGGTTCAGAGAGGACTTGG + Intronic
933394283 2:81711974-81711996 ATGCTGATTCAGAGCATACATGG + Intergenic
933504593 2:83161389-83161411 ATGCTGATTCAGAGCATATGTGG + Intergenic
934305935 2:91821985-91822007 GCGCTGATTCAGAGCACACATGG - Intergenic
934327321 2:92030757-92030779 GCGCTGATTCAGAGCACACATGG + Intergenic
934465704 2:94261337-94261359 GCGCTGATTCAGAGCACACATGG + Intergenic
935184134 2:100716280-100716302 ACACTGATTCAGAGCGTACGTGG - Intergenic
935424919 2:102909949-102909971 ACACTGATTCAGAGCATACATGG + Intergenic
935564115 2:104588870-104588892 ACACTGATTCAGAGCATACATGG + Intergenic
937581882 2:123497752-123497774 ACACTGATTCAAAGCATACATGG + Intergenic
937785015 2:125886341-125886363 ATGCTGATTCAGCACATACATGG + Intergenic
937802513 2:126096964-126096986 TGGGTGATTCAGAGTGTACATGG - Intergenic
937852385 2:126647352-126647374 ATGCTGATGCAGAGCATACATGG + Intergenic
939214054 2:139213625-139213647 ATGCTGATTCAGAGCATACATGG - Intergenic
939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG + Intergenic
939806427 2:146779856-146779878 ATGCTGATTCAGAGCGTACATGG - Intergenic
939826440 2:147021477-147021499 ATTCTGATGCAGAGCATTCAAGG - Intergenic
940171121 2:150831319-150831341 ACACTGATTCAAAGCATACATGG + Intergenic
941330478 2:164173181-164173203 GAGCTGATTCAGAGCCTACATGG + Intergenic
942156326 2:173132387-173132409 AAGCTGATACACAGCCTACATGG - Intronic
943239094 2:185361603-185361625 ACACTGATTCAGAACATACATGG + Intergenic
943317745 2:186410942-186410964 ATGCTGATTCAGAGCATACATGG + Intergenic
943383876 2:187179704-187179726 ATGCTGATTCATAGCATACACGG + Intergenic
945642370 2:212445224-212445246 ATGCTGATTCAGATCATACACGG - Intronic
945725657 2:213470114-213470136 ATGCTGATTCAGAACATGCATGG + Intronic
946703564 2:222436412-222436434 ACACTGATTCAGAGCATACAAGG + Intronic
947441042 2:230121640-230121662 ACACTGATTCAGAGCATACACGG - Intergenic
948539757 2:238681848-238681870 TTGCTGTTTCAGAGAGCACATGG + Intergenic
1169625105 20:7557780-7557802 GTGCTCATTCATAGTGTACATGG + Intergenic
1174983108 20:55419737-55419759 ATGCTGATTCAGCAGGTGCATGG - Intergenic
1175848625 20:62073942-62073964 ATGCTGATTCAGAGCATGCATGG - Intergenic
1176596710 21:8704544-8704566 GCGCTGATTCAGAGCACACATGG + Intergenic
1176737860 21:10568744-10568766 ATACTGATTCAGTGGGTCCAGGG - Intronic
1178061880 21:28861747-28861769 ACACTGATTCACAGCATACATGG - Intergenic
1178827010 21:36025438-36025460 ATTCTGATTCAGTGGGTCCAGGG + Intergenic
1179414951 21:41191148-41191170 ACGCTGATTCAGAGCATACACGG + Intronic
1180279631 22:10681986-10682008 GCGCTGATTCAGAGCACACATGG + Intergenic
1180586843 22:16900516-16900538 GCGCTGATTCAGAGCACACATGG + Intergenic
1180590955 22:16936982-16937004 GCGCTGATTCAGAGCCTACAAGG + Intergenic
1184603365 22:45556979-45557001 ACCCTGATTCAGAGCATACATGG + Intronic
949125469 3:441721-441743 ACACTGATTCAGAGCATACATGG + Intergenic
949169847 3:985228-985250 ACACTGATTCAGAGCATACACGG + Intergenic
949445801 3:4132451-4132473 ATGGTGATTCAGAGCATACATGG - Intronic
949639092 3:6014900-6014922 ATGCTGATTCAGAGCATACATGG - Intergenic
950267045 3:11581860-11581882 CTGCTGATTCGGGGAGTACAAGG - Intronic
950858780 3:16129065-16129087 ATGCTGATGCAGTGGGTCCAGGG - Intergenic
951291162 3:20873659-20873681 ACGCTGATACAGAGAATACATGG + Intergenic
951384712 3:22028905-22028927 ATGCTGATTCAGAGCACACATGG - Intronic
954054400 3:48009650-48009672 ACGCTGATTCAGAGGATACACGG - Intronic
954511300 3:51128300-51128322 ATTTTGATTCAGAGCATACATGG + Intronic
954665575 3:52249689-52249711 ATGCTGATACACAGCACACAGGG + Exonic
955418448 3:58714473-58714495 ATGCTGATTCAGAGCATATATGG + Intergenic
956307050 3:67837016-67837038 ACACTGATTCAGAGCATACACGG - Intergenic
956703714 3:71981515-71981537 ACGTTGATTCAGAGCATACATGG + Intergenic
957247384 3:77732513-77732535 ACGCTGATTCAGAACATACATGG + Intergenic
957754772 3:84470814-84470836 ACACTGATTCAGAGCATACATGG - Intergenic
958487497 3:94731088-94731110 ATGCTGATTCAAAGCATACATGG + Intergenic
958934494 3:100241997-100242019 ATGCTGATTCAGAGCACACATGG - Intergenic
960349701 3:116577086-116577108 AGGCTGATTCAGAGCATACATGG - Intronic
960494555 3:118359371-118359393 ATGCTGATTCAGAGCATATATGG + Intergenic
961710788 3:128826630-128826652 ATGCTGATTCAGAGCATACACGG + Intergenic
962403731 3:135082838-135082860 AGGCTGATTCATAGAGTACTGGG + Intronic
963331615 3:143921988-143922010 ATGCTGATTCAGAGCATACATGG + Intergenic
963970122 3:151420569-151420591 ATACTGATTAAGAGCATACACGG + Intronic
964445313 3:156751962-156751984 ATGCTGCTTCAGAGAAAACATGG - Intergenic
964679049 3:159317527-159317549 ATACTGGTTCAGAGCATACATGG + Intronic
965226576 3:165999392-165999414 CTGCTGATTCAGCCCATACATGG + Intergenic
966445881 3:179999960-179999982 ACGCTGATTCAGAGCATACATGG - Intronic
967831979 3:193927367-193927389 ACGCTGATTCAGAGCATACAGGG - Intergenic
968800382 4:2739517-2739539 ATGCTGATTCAGAGCATACATGG - Intergenic
968907210 4:3459799-3459821 ATGCTGATTCAGAGCATACATGG - Intergenic
969991239 4:11265294-11265316 ATGTTGATGAAGAACGTACAAGG - Intergenic
971100824 4:23465033-23465055 ATGCTGATTCAGAGCATACACGG + Intergenic
971687197 4:29785707-29785729 ATGCTGATTCAGAGCATACATGG + Intergenic
972095671 4:35344095-35344117 ATACTTATTCAGAGTATACATGG - Intergenic
972806118 4:42530760-42530782 ATGCTGATTCAGAGCATACACGG - Intronic
973103106 4:46296130-46296152 ATGCTGATTCAGAGCATACACGG - Intronic
973118607 4:46490427-46490449 ATGCTGATTCTGAGCACACATGG - Intergenic
973120816 4:46519520-46519542 ACGCTGATTCAGAGCATACATGG + Intergenic
973546891 4:51991216-51991238 ATGATGATTGATAGCTTACATGG + Intergenic
973598837 4:52520914-52520936 ATTCTGATTCAGAGGGTCTAGGG + Intergenic
974289742 4:59914125-59914147 ATGCTAATTCAGAGCATACATGG - Intergenic
974727408 4:65813923-65813945 GTGCTGGTTCAGAGCATACACGG - Intergenic
975398950 4:73911834-73911856 TTGTTGATTCAGGGGGTACAGGG - Intergenic
975982425 4:80175891-80175913 ACACTGATTCAGAGCATACATGG + Intergenic
977489900 4:97698693-97698715 AGGCTGATTCAGAGCATTCATGG + Intronic
977701555 4:100028510-100028532 ATGCTGATTCAGAGCATACATGG + Intergenic
977833034 4:101616457-101616479 ACACTGATTTAGAGCATACATGG + Intronic
977930214 4:102742433-102742455 ATGCTGATTCAGAGCATACATGG + Intronic
978341382 4:107724162-107724184 ATGCTGATTCAGAGCCTACACGG + Intergenic
978771958 4:112466401-112466423 ACACTGATTCAGAGCATACATGG + Intergenic
979075572 4:116265414-116265436 ACGCTGATTCAGAGCATACATGG - Intergenic
979767198 4:124475983-124476005 ATGCTGATTCAGAGCATACAAGG - Intergenic
979898230 4:126187680-126187702 ACAGTGATTCAGAGCATACATGG + Intergenic
980405704 4:132352403-132352425 ATGCTGATCCAGAGCATACACGG + Intergenic
980497449 4:133604691-133604713 ATGCTGATTCAGAGCATACACGG + Intergenic
980602397 4:135041390-135041412 ACACTGATTCAGGGCATACACGG - Intergenic
980841193 4:138263611-138263633 AAGCTGACTCAGAGAGCACATGG + Intergenic
980957921 4:139447299-139447321 ACGCTGATTCAGGGTATACATGG - Intergenic
981712994 4:147727336-147727358 AAGCTGATTCAGTGAGGACAGGG + Intergenic
981835190 4:149045322-149045344 ATGCTGATTCAGAGCATACATGG - Intergenic
983027592 4:162756669-162756691 ATACTGATTCAGAGCATATGTGG - Intergenic
983810878 4:172060517-172060539 ATGCAGATTCAGATCATAAAGGG - Intronic
986036850 5:3949065-3949087 ACACTGATTCAGAGCATACATGG + Intergenic
986261453 5:6151137-6151159 ATGCTGATTCAGAGCATACACGG + Intergenic
986938152 5:12917366-12917388 ACACAGATTCAGAGCATACACGG + Intergenic
987153375 5:15063051-15063073 ACGCTGATTCAGGGCATACATGG - Intergenic
988160632 5:27515484-27515506 ATGCTGATTCAGAGCATGCATGG + Intergenic
988169026 5:27631451-27631473 ATGCTCATTCAGAGCATACAGGG + Intergenic
988205112 5:28123966-28123988 ATGCTGATTCAGAGCATACACGG + Intergenic
988228940 5:28449510-28449532 AAGCTGATTCAGAGCATACATGG - Intergenic
988267563 5:28971963-28971985 ATTCTGATTCAGAACATACATGG + Intergenic
988562316 5:32292222-32292244 ACGCTGATTCAGAGCATACATGG - Intronic
989044959 5:37265898-37265920 ATGCTGATTCAGAGCATACATGG + Intergenic
989307316 5:39973236-39973258 ATGCTGATTCAGAGAATACATGG + Intergenic
989457455 5:41660381-41660403 ATGCCAATTCAGAGCATACATGG + Intergenic
989486196 5:41994973-41994995 GTGCTGATTCAGAGCATACATGG + Intergenic
990748137 5:58982242-58982264 ATGCTGATTCAGAGCATATATGG + Intronic
991013601 5:61909504-61909526 ACGCTGATTCAGAGCATACACGG + Intergenic
991033744 5:62107306-62107328 ACGCTGATTCAGAGCATACATGG - Intergenic
991946336 5:71901507-71901529 ATGCTGATTCAGAGCATACACGG - Intergenic
992948455 5:81832842-81832864 ATGCTGATGCAGCGGGTCCAGGG + Intergenic
993231725 5:85246166-85246188 ATGCTTATTCAGAGCATACATGG + Intergenic
993292003 5:86084562-86084584 ATGCTTATTCAGAGCCTACTAGG - Intergenic
993320011 5:86459958-86459980 GTGCTGATTCAGAGCATACATGG - Intergenic
993367152 5:87048481-87048503 ACACTAATTCAGAGCATACACGG + Intergenic
993412390 5:87590433-87590455 ATGTTAATTCAGGGCATACATGG + Intergenic
993791964 5:92220294-92220316 ACACTGATTCAGAACATACATGG - Intergenic
994917134 5:105994856-105994878 ACACTGATTCAGAGCATACATGG - Intergenic
996018744 5:118569257-118569279 ATGCTGATGCAGAGCATAAACGG - Intergenic
997073046 5:130640673-130640695 ATGCTGCTTCAGGGAGTCCAGGG - Intergenic
1000417164 5:160995317-160995339 AAGCTGATTCAGAGTGTACATGG - Intergenic
1000730623 5:164829659-164829681 ACACTGATTCAGAGTATACACGG - Intergenic
1001303661 5:170555952-170555974 AGGCTGGTTCAGAGGGTACCTGG - Intronic
1002998171 6:2306149-2306171 ACGCTGATTCAGAGCATACATGG - Intergenic
1003535165 6:6970060-6970082 ATGCTGACTCACAGCCTACGTGG + Intergenic
1003758801 6:9151472-9151494 ACGCTGATTCAGAGAATACATGG - Intergenic
1003791414 6:9551434-9551456 ATGCTGATTCAGAGAACACATGG - Intergenic
1007276011 6:40674378-40674400 GTGCTCACTCAGAGCTTACAGGG + Intergenic
1008400462 6:51056819-51056841 ATGCTGATTCAGAGCATACACGG - Intergenic
1008820580 6:55626521-55626543 ATGCTGAATCAGAGCATACATGG - Intergenic
1009806671 6:68608331-68608353 AGGTTGATTCAGAGCATACATGG - Intergenic
1009851730 6:69207593-69207615 ATGCTGATTCAGAGCATACATGG + Intronic
1010291948 6:74147658-74147680 ACACTGACTCAGAGCATACATGG + Intergenic
1010323756 6:74541877-74541899 ATGCTGATTCATAGCATACATGG - Intergenic
1010580627 6:77592860-77592882 ATGCTGATTCAGAGTGTACATGG + Intergenic
1011039167 6:83011928-83011950 ATGCTGATTCAGAGCATACACGG + Intronic
1012820961 6:104084148-104084170 ATACTGGTTCAGAGCATACACGG - Intergenic
1012920595 6:105218161-105218183 ATGCTGATTCAGAGCATACATGG + Intergenic
1013406849 6:109851122-109851144 ACACTGATTCAGAGCATACACGG - Intergenic
1013623802 6:111917556-111917578 ATGCTGATTCAGAGCATACATGG + Intergenic
1013818534 6:114128078-114128100 ATGCTGATTTAGTGAGTTCAGGG - Intronic
1014417182 6:121196795-121196817 ATGCTGATTCAGAGCACACGTGG - Intronic
1014455912 6:121634909-121634931 ACACTGACTCAGAGCATACATGG - Intergenic
1014534004 6:122595217-122595239 ATGCTGATTCAGAGCATACATGG + Intronic
1014953127 6:127582947-127582969 ATGCTGACTCATAACGCACAAGG - Intronic
1015443096 6:133271175-133271197 ATGCTGATTCAGAGCGTACATGG + Intronic
1015475944 6:133658869-133658891 ACGCTGATTCAGAACATACATGG - Intergenic
1015678758 6:135781027-135781049 CAGCTGATGCAGAGCCTACAGGG + Intergenic
1016576080 6:145571202-145571224 ATGCTGATTCAGAGCATACACGG + Intronic
1020396844 7:7726508-7726530 ACACTGATTCAGAGCATACACGG - Intronic
1020710500 7:11598657-11598679 ATGCTGATTCAGAGCATTCACGG - Intronic
1020822370 7:12986476-12986498 GTGCTGATTCAAAGAGTATATGG + Intergenic
1021294348 7:18886151-18886173 ATGCAGAGTAAGAGCGAACATGG - Intronic
1026046296 7:66907735-66907757 ATGCTGATTCAGAGCAGACATGG + Intergenic
1027474299 7:78610138-78610160 ATACTAATTCAGAGCATACATGG + Intronic
1028238061 7:88384515-88384537 ACGCTGATTCAGAACATACATGG - Intergenic
1030277739 7:107738022-107738044 ACGCTGCTTCAGAGCATCCATGG - Intergenic
1030328083 7:108242946-108242968 ATGCTTTTTCAGAGTATACATGG + Intronic
1030355600 7:108538913-108538935 ATGCTGATTCAGAGAATACATGG - Intronic
1030368949 7:108675428-108675450 ATGCTGATTCAGAGCACATATGG - Intergenic
1030457270 7:109791676-109791698 AAGCTGAATCAGACCATACACGG + Intergenic
1030883092 7:114905158-114905180 ATGCTGATTCAGAGCATACACGG + Intergenic
1031676729 7:124619670-124619692 ACGCTGATTCAGAGCATACAGGG - Intergenic
1032152909 7:129445583-129445605 ATGCTGATTCAGAGCATACACGG + Intronic
1032279646 7:130490767-130490789 ATGCTGATTTAGCACCTACAGGG - Intronic
1033076455 7:138254429-138254451 ATGCTGATTCAGAGCATACATGG - Intergenic
1034170053 7:149055973-149055995 ACGCTGATTCAGAGCATACATGG - Intergenic
1039323991 8:36465160-36465182 ATGCTGATTCAGAGCATACTCGG + Intergenic
1041986371 8:63925856-63925878 ATGCTGATCCAGAGCATACATGG - Intergenic
1043258104 8:78160204-78160226 ATGCTGATGCAGAGCATATATGG - Intergenic
1044150981 8:88774456-88774478 ATGCCGATTCAGAGCATACATGG - Intergenic
1044632953 8:94297018-94297040 ATGCTGATTCACAGCATACACGG + Intergenic
1045221960 8:100207948-100207970 ACACTGATTCAGAGTATACACGG - Intronic
1046035616 8:108837366-108837388 ATCCTTATCCAGAGTGTACAGGG - Intergenic
1046417466 8:113936411-113936433 ATGCTGATTCAGAGCATACACGG + Intergenic
1047453802 8:124990690-124990712 ATGCTGATTCAGAGCATATACGG - Intergenic
1052368839 9:27642222-27642244 ACACTGATTCAGAGCATACATGG - Intergenic
1053695767 9:40638117-40638139 GCGCTGATTCAGAGCACACATGG + Intergenic
1053942755 9:43269154-43269176 GCGCTGATTCAGAGCACACATGG + Intergenic
1054307014 9:63437335-63437357 GCGCTGATTCAGAGCACACATGG + Intergenic
1054405745 9:64761323-64761345 GCGCTGATTCAGAGCACACATGG + Intergenic
1054439372 9:65246810-65246832 GCGCTGATTCAGAGCACACATGG + Intergenic
1054491035 9:65775129-65775151 GCGCTGATTCAGAGCACACATGG - Intergenic
1055103291 9:72487093-72487115 ACACTAATTCAGAGCATACATGG - Intergenic
1056353670 9:85776939-85776961 ATGCTGATGCAGAGCATACACGG + Intergenic
1057100408 9:92353877-92353899 ATGCTGATTCAGAGCATACATGG + Intronic
1058020093 9:100077447-100077469 ATGTTGATTCAGAGCATACATGG - Intronic
1058124762 9:101178745-101178767 ACACTGATTCGGAGCATACATGG - Intronic
1058543994 9:106041373-106041395 ATGCTGATTCAGAGCATATATGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1202778212 9_KI270717v1_random:11729-11751 GCGCTGATTCAGAGCACACATGG + Intergenic
1186279701 X:7978501-7978523 ATGCTGATTCAGAGTATACACGG - Intergenic
1186469571 X:9810754-9810776 GCGCTGATTCAGAGCATACATGG + Intronic
1187947887 X:24444239-24444261 ATGATGTTTCAGAGCGTGGAGGG - Intergenic
1189017099 X:37295810-37295832 ATGCTGCTTCAAAGGGTGCAAGG - Intergenic
1189394559 X:40609406-40609428 ATGCTGATTCAGAGAGATTAAGG - Intergenic
1190935016 X:54991970-54991992 AAGGTGATTCAGACCTTACAGGG + Intronic
1190996567 X:55616102-55616124 ACACTGATTCAGAGTATACACGG + Intergenic
1191658612 X:63628424-63628446 CCACTGATTCAGAGCATACATGG + Intergenic
1191759541 X:64631280-64631302 ATGTTGATTCAGAGCATACAAGG - Intergenic
1191769319 X:64738709-64738731 ATGCTGATTCAGAGCATACATGG + Intergenic
1191941077 X:66482508-66482530 AAGCTGATTCAGAGCATACACGG + Intergenic
1191946533 X:66540405-66540427 ATGCTGATTAAGAGCATAAATGG - Intergenic
1192297520 X:69866639-69866661 ATGCTGATTCAGAGCATACACGG + Intronic
1192898892 X:75473277-75473299 ATGCTGATTGAAAGCATACACGG - Intronic
1193027991 X:76865910-76865932 ATTCTGTTTCAGAGCGAACTTGG + Intergenic
1193053682 X:77127147-77127169 ACGCTGATTCGGAGCATACATGG - Intergenic
1193297955 X:79854037-79854059 ATGCTGATTCAGAGCATATATGG - Intergenic
1193573528 X:83173797-83173819 ATGCTGATTCAGAGCATACGCGG + Intergenic
1193833140 X:86311487-86311509 ATGGTGATTCAGAGCATACATGG - Intronic
1193841369 X:86412383-86412405 ATGCTGATTCAGAGCATACATGG + Intronic
1193905504 X:87238543-87238565 ACGCTGATTCAGAGCATACACGG + Intergenic
1193914633 X:87350568-87350590 ACACTGATCCAGAGCATACACGG + Intergenic
1194072136 X:89339165-89339187 ATGCTGATTCAAAGCACATACGG + Intergenic
1194210467 X:91063735-91063757 ATGCTGATTCAGAGCATATGTGG - Intergenic
1194443718 X:93962475-93962497 ACACTGATTCAGAGCATACATGG - Intergenic
1194485291 X:94478696-94478718 ATGCTGATTTAGAGCATTCCTGG - Intergenic
1194513242 X:94820878-94820900 ACACTGATTCAGAGCCAACATGG + Intergenic
1194584302 X:95714444-95714466 ACGCTGATTCAGAGCATACATGG - Intergenic
1195809607 X:108815464-108815486 ATGCTGATTCAGGGCATACAAGG + Intergenic
1196275812 X:113764080-113764102 AAGCTGATTCCGAGCATACATGG - Intergenic
1196489456 X:116249408-116249430 GTGCTGATGCAGGGGGTACAGGG - Intergenic
1197002476 X:121454300-121454322 ATGCTGATTCAGAGCATACACGG - Intergenic
1197074251 X:122336492-122336514 ACACTGATTCAGAGCATACATGG + Intergenic
1197244858 X:124157616-124157638 ACGCTGATTCAGAGCATACATGG + Intronic
1197386599 X:125810864-125810886 ATGCTGATTCAGAGTACACATGG + Intergenic
1197420066 X:126227715-126227737 ATGCTGACTCAGAGCATACAGGG - Intergenic
1197477197 X:126940180-126940202 ATGCTGATTCAGAGCATACATGG + Intergenic
1197592059 X:128420770-128420792 ATGCTGATTTAGAGCATACACGG - Intergenic
1198701485 X:139401680-139401702 ATGCTGATTCAGAGCATACATGG - Intergenic
1198934220 X:141889241-141889263 ACACTGATTCAGAGCATACAGGG - Intronic
1199144276 X:144347592-144347614 ATGCTAATTCAGAGCATACATGG + Intergenic
1199310242 X:146313018-146313040 ATGCTGATTCAGAACATACATGG + Intergenic
1200340287 X:155389257-155389279 ACGCTGATTGAGAGCATACATGG + Intergenic
1200514941 Y:4133005-4133027 TTTCAGATTCAGAGAGTACATGG + Intergenic
1200521454 Y:4213400-4213422 ATGCTGATTCAGAGCATACAGGG - Intergenic
1200726380 Y:6674916-6674938 ATGCTGATTCAAAGCACATATGG + Intergenic
1200745871 Y:6903491-6903513 ATGCTGATTCAGAGCATACATGG + Intergenic
1200972966 Y:9176330-9176352 ATGCTGATTCACAGCACACATGG + Intergenic
1201796499 Y:17902252-17902274 ATGCTGATTCAGAGAACATATGG + Intergenic
1201805056 Y:18003733-18003755 ATGCTGATTCAGAGAACATATGG - Intergenic
1202138108 Y:21688179-21688201 ATGCTGATTCACAGCACACATGG - Intergenic
1202357882 Y:24071315-24071337 ATGCTGATTCAGAGAACATATGG + Intergenic
1202512896 Y:25598798-25598820 ATGCTGATTCAGAGAACATATGG - Intergenic
1202596113 Y:26542057-26542079 ATACTGATTCAGTGGGTCCAGGG - Intergenic