ID: 1015445355

View in Genome Browser
Species Human (GRCh38)
Location 6:133297567-133297589
Sequence GGTGTTAGTAAGGCAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015445355_1015445357 -7 Left 1015445355 6:133297567-133297589 CCTGGTTTTGCCTTACTAACACC 0: 1
1: 0
2: 1
3: 12
4: 276
Right 1015445357 6:133297583-133297605 TAACACCCAAGTTTGAGTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1015445355_1015445358 -6 Left 1015445355 6:133297567-133297589 CCTGGTTTTGCCTTACTAACACC 0: 1
1: 0
2: 1
3: 12
4: 276
Right 1015445358 6:133297584-133297606 AACACCCAAGTTTGAGTTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015445355 Original CRISPR GGTGTTAGTAAGGCAAAACC AGG (reversed) Intronic
900009577 1:94030-94052 GATGTTAAAAAGGCAAAACTGGG - Intergenic
900025687 1:270607-270629 GATGTTAAAAAGGCAAAACTGGG - Intergenic
900035452 1:404369-404391 GATGTTAAAAAGGCAAAACTGGG - Intergenic
900057073 1:640119-640141 GATGTTAAAAAGGCAAAACTGGG - Intergenic
900947266 1:5838103-5838125 CATGTTAGCAAGGCAAACCCGGG - Intergenic
902128941 1:14241612-14241634 GGAGTCAGTAAGCCAAAACATGG - Intergenic
903395781 1:23000924-23000946 TTTGTTAGGATGGCAAAACCAGG + Intergenic
905060309 1:35134473-35134495 TTTGTTAGGATGGCAAAACCAGG + Intergenic
905594759 1:39196994-39197016 GCTGTTAGTAAGGGATATCCTGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909729674 1:78876023-78876045 TTTGTTAGGATGGCAAAACCAGG - Intergenic
910120738 1:83786882-83786904 GCTGTTAATAGGCCAAAACCTGG + Intergenic
911510422 1:98803398-98803420 TTTGTTAGGATGGCAAAACCAGG + Intergenic
911984045 1:104599543-104599565 ATTGTTAGGATGGCAAAACCGGG - Intergenic
913245369 1:116865834-116865856 TTTGTTAGGATGGCAAAACCAGG - Intergenic
914795036 1:150913209-150913231 GGTGTTAGTAAGACCATACTGGG - Intergenic
916004963 1:160651785-160651807 GGTGTTTGTAAGGCAGGATCTGG + Intergenic
919258922 1:195163655-195163677 GCAGTTATTAAGGCAAAAGCTGG - Intergenic
920672222 1:208013218-208013240 GGTGTGAGTTATGCAAAAACTGG - Intergenic
920908224 1:210190843-210190865 TTTGTTAGGATGGCAAAACCAGG - Intergenic
921339865 1:214124152-214124174 TGAGTAAGGAAGGCAAAACCAGG - Intergenic
921561918 1:216669328-216669350 GGTTCCAGTAAGTCAAAACCAGG + Intronic
922257990 1:223909924-223909946 GATGTTAAAAAGGCAAAACTGGG - Intergenic
923909993 1:238430926-238430948 GGTGGAAGGAAGGCAAAGCCGGG - Intergenic
1062930964 10:1352295-1352317 TTTGTTAGGATGGCAAAACCAGG - Intronic
1063583714 10:7332325-7332347 TGTGTTAATAAGACAAAAACAGG + Intronic
1065437835 10:25720016-25720038 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1068179443 10:53501177-53501199 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1070635645 10:78125140-78125162 GGTGTCAGTAAAGCAAATGCAGG + Intergenic
1071056885 10:81521456-81521478 TGTGTTAGTAAATCAATACCTGG - Intergenic
1071961321 10:90810972-90810994 TTTGTTAGGATGGCAAAACCAGG - Intronic
1074019238 10:109565925-109565947 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1075014124 10:118897639-118897661 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1077883565 11:6369371-6369393 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1078789230 11:14526187-14526209 TTTGTTAGGATGGCAAAACCAGG - Intronic
1079230733 11:18646609-18646631 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1079522410 11:21343659-21343681 TGTGTTACAAAGGCAAAACTGGG - Intronic
1079847477 11:25489369-25489391 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1081159938 11:39738130-39738152 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1084613075 11:70216479-70216501 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1085570427 11:77553604-77553626 TTTGTTAGGATGGCAAAACCAGG - Intronic
1085988217 11:81809771-81809793 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1086134627 11:83433754-83433776 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1087839332 11:102906227-102906249 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1088555164 11:111053754-111053776 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1090107394 11:123867727-123867749 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1090546291 11:127771227-127771249 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1091689335 12:2584986-2585008 AGTGTTAGGAAGGCAAGACGGGG + Intronic
1092415978 12:8290731-8290753 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1093812624 12:23508175-23508197 TTTGTTAGAATGGCAAAACCAGG + Intergenic
1094062645 12:26331335-26331357 GGGGGAAGTAAGGCAAATCCTGG + Intergenic
1094400890 12:30059543-30059565 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1094410882 12:30167993-30168015 AGTGTTACTAAGGCAAAGCAGGG + Intergenic
1094825977 12:34269354-34269376 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1095806553 12:46326085-46326107 ATTGTTAGGATGGCAAAACCAGG + Intergenic
1097592541 12:61590217-61590239 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1098629823 12:72711041-72711063 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1100130763 12:91490335-91490357 GGAGTTAGTAACGCAAAGCATGG - Intergenic
1102604721 12:114059573-114059595 TTTGTTAGTATGGCAAAACCAGG - Intergenic
1103194988 12:119036338-119036360 GGTGTTTGTAAGGCTCAGCCAGG + Intronic
1108202903 13:48059942-48059964 TTTGTTAGGATGGCAAAACCAGG - Intronic
1108507298 13:51124090-51124112 GTTGTTAGAAATGCAAAAACTGG - Intergenic
1108947648 13:56043873-56043895 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1109001502 13:56811325-56811347 GCAGGTGGTAAGGCAAAACCAGG - Intergenic
1110650281 13:77935474-77935496 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1111224977 13:85258129-85258151 GATGTGAGTAAAGCAAAAGCTGG + Intergenic
1112237034 13:97645862-97645884 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1113454912 13:110441491-110441513 GGTGTGATTACGGCAAAGCCTGG - Intronic
1113733744 13:112661302-112661324 GGTGTTAGTAAGGGGAAAACAGG - Intronic
1114391906 14:22318234-22318256 AGAGTTAGTAAGGGAAGACCTGG + Intergenic
1116179885 14:41519513-41519535 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1116702186 14:48257528-48257550 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1116760873 14:49011997-49012019 GCAGTTTGTAAGGCAATACCTGG + Intergenic
1117927812 14:60802745-60802767 GGTGTTAATCAGGTAAACCCGGG + Intronic
1117982851 14:61358872-61358894 GGAGTTACTAAGTCAAAAGCAGG - Intronic
1119210671 14:72829332-72829354 GTTGTAAGTAAGGCAATGCCTGG - Intronic
1120618451 14:86734886-86734908 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1120659722 14:87237017-87237039 TTTGTTAGGAATGCAAAACCAGG + Intergenic
1121193054 14:92046700-92046722 TTTGTTAGGATGGCAAAACCAGG + Exonic
1121389799 14:93564284-93564306 TTTGTTAGGATGGCAAAACCAGG + Intronic
1121484565 14:94304690-94304712 GGTTTTAGGAAGGTAAATCCAGG + Intronic
1122507851 14:102243186-102243208 TTTGTTAGGATGGCAAAACCAGG - Intronic
1125832595 15:42727543-42727565 GATGTGAGAAAGGAAAAACCAGG + Intronic
1126451541 15:48814105-48814127 TGAGGTAGTAAGGAAAAACCAGG + Intergenic
1130388224 15:83431646-83431668 GCTGTCTGTAAGGGAAAACCAGG - Intergenic
1130781275 15:87043215-87043237 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1130945735 15:88549644-88549666 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1132196424 15:99917608-99917630 GGAGTTAGAAAGGCCAAACCTGG + Intergenic
1133602323 16:7351672-7351694 GGTGTCTCTAAGGCAAACCCAGG - Intronic
1133823641 16:9258643-9258665 GGTGGTAGTATCGCAACACCTGG + Intergenic
1134914946 16:18061647-18061669 GGTGTCAGAAATGCAAATCCCGG + Intergenic
1138228048 16:55315785-55315807 GTTGTTAGCAAGGAAAGACCAGG + Intergenic
1142454752 16:90212872-90212894 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1149135036 17:53354056-53354078 GCTGTGAGCAATGCAAAACCTGG - Intergenic
1150375550 17:64678588-64678610 GGTCAATGTAAGGCAAAACCAGG - Intergenic
1153881470 18:9425258-9425280 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1154403274 18:14063373-14063395 GGTACTAGTCAGGTAAAACCTGG - Intronic
1155174039 18:23287615-23287637 TTTGTTAGGATGGCAAAACCAGG - Intronic
1156251723 18:35358472-35358494 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1156302463 18:35847487-35847509 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1156958398 18:42994445-42994467 TTTGTTAGGATGGCAAAACCAGG - Intronic
1157626734 18:49057054-49057076 TGTGTTAGCAATGTAAAACCTGG + Intronic
1159980524 18:74773895-74773917 GGTGTTTATAAAGCAAGACCTGG - Intronic
1160261222 18:77295979-77296001 GCTGCAAGCAAGGCAAAACCAGG + Intergenic
1160438928 18:78874110-78874132 GCTTTGAGTGAGGCAAAACCAGG - Intergenic
1161712365 19:5856151-5856173 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1162634023 19:11952233-11952255 AGAATAAGTAAGGCAAAACCCGG - Intronic
1164219403 19:23179719-23179741 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1166359430 19:42246798-42246820 GGTGTTAGGAAGGAAAAGTCAGG + Intronic
1166926922 19:46275478-46275500 TTTGTTAGGATGGCAAAACCAGG + Intergenic
925697772 2:6599446-6599468 GGAGATAGTAAGACAAAAGCGGG + Intergenic
928827448 2:35439243-35439265 TTTGTTAGGATGGCAAAACCAGG + Intergenic
928877237 2:36054225-36054247 GCTGCTGGTATGGCAAAACCAGG + Intergenic
929004631 2:37383143-37383165 TTTGTTAGGATGGCAAAACCAGG + Intergenic
929684318 2:44021186-44021208 TTTGTTAGGATGGCAAAACCAGG + Intergenic
930098831 2:47587639-47587661 TTTGTTAGGATGGCAAAACCAGG + Intergenic
930487151 2:52024251-52024273 TTTGTTAGGATGGCAAAACCAGG + Intergenic
931948465 2:67335168-67335190 TTTGTTAGGATGGCAAAACCAGG - Intergenic
932159222 2:69445630-69445652 TTTGTTAGGATGGCAAAACCAGG + Intergenic
932296052 2:70624179-70624201 TTTGTTAGGATGGCAAAACCAGG - Intronic
933459875 2:82568735-82568757 CCTGTGAGTAAGACAAAACCAGG + Intergenic
934541135 2:95176042-95176064 GGTCTAAGTAAAGCAAAGCCAGG - Intronic
939178391 2:138778659-138778681 GGTGTGTGTAAGGAAAAGCCTGG - Intronic
940183935 2:150962036-150962058 TTTGTTAGGATGGCAAAACCAGG - Intergenic
941455958 2:165712478-165712500 TTTGTTAGGATGGCAAAACCAGG + Intergenic
941935683 2:170979784-170979806 TTTGTTAGGATGGCAAAACCAGG + Intergenic
942515203 2:176745431-176745453 GGTATTAGTCAGTCAAAATCAGG - Intergenic
942730079 2:179053906-179053928 TTTGTTAGGATGGCAAAACCAGG + Intergenic
943450347 2:188036795-188036817 TTTGTTAGGATGGCAAAACCAGG - Intergenic
943951087 2:194133030-194133052 TTTGTTAGGATGGCAAAACCAGG + Intergenic
944251270 2:197581837-197581859 TTTGTTAGGATGGCAAAACCAGG - Intronic
945301245 2:208218214-208218236 CTTGTTAGGATGGCAAAACCAGG + Intergenic
945537211 2:211032616-211032638 GGTTTTAGTCAGGCAAAACCAGG - Intergenic
945782356 2:214191409-214191431 GAAGTTAGAAAGGAAAAACCAGG + Intronic
947850366 2:233282799-233282821 GGTGTTATCAAGGCACAAACTGG + Intronic
949086213 2:242157531-242157553 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1170325278 20:15149971-15149993 TTTGTTAGGATGGCAAAACCAGG + Intronic
1170327015 20:15167743-15167765 TGTGTTTGTAAGAAAAAACCTGG - Intronic
1171007164 20:21477976-21477998 GGTGTAAGAAAGGTAAAACTCGG + Intergenic
1173652283 20:44674092-44674114 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1173763569 20:45586349-45586371 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1174876319 20:54230373-54230395 GCTGCTATTAATGCAAAACCAGG + Intergenic
1176223828 20:63982962-63982984 GGTGTTAGTAAGTGATAACCAGG + Intronic
1177102882 21:16917558-16917580 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1178455010 21:32741084-32741106 GGTGGGAGTAAGGAATAACCAGG + Intronic
1179650158 21:42803185-42803207 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1180193924 21:46182476-46182498 GGTCTGAGTAAAGCAAGACCAGG - Intronic
1183635418 22:39059453-39059475 TTTGTTAGTACGGCAAAACCAGG + Intronic
1183756869 22:39775583-39775605 ATTGTTAGTAAAGAAAAACCTGG - Intronic
1183868441 22:40722836-40722858 CTTGTTAGGAAGGCAAAATCTGG - Intergenic
949620072 3:5800918-5800940 GGTGAAAATAAGGTAAAACCAGG - Intergenic
950899712 3:16486560-16486582 GCTGTTAGTCAGGCAAAAGATGG - Intronic
951316112 3:21191341-21191363 TTTGTTAGGATGGCAAAACCAGG + Intergenic
952894986 3:38072645-38072667 TTTGTTAGGATGGCAAAACCAGG + Intronic
953656321 3:44857660-44857682 TTTGTTAGGATGGCAAAACCAGG + Intronic
954143025 3:48620146-48620168 GGTGTGAGGAAGGGAAATCCAGG - Intergenic
956233293 3:67040836-67040858 TTTGTTAGGATGGCAAAACCAGG + Intergenic
956345285 3:68271331-68271353 AGTGTGAGTAAGGCAAAGCCAGG - Intronic
956548786 3:70437006-70437028 TTTGTTAGGATGGCAAAACCAGG + Intergenic
956709425 3:72026556-72026578 TTTGTTAGGATGGCAAAACCAGG - Intergenic
958751213 3:98194663-98194685 TTTGTTAGGATGGCAAAACCAGG - Intronic
959961588 3:112304210-112304232 GGCGTTTGTAAGGCAAGCCCAGG + Intergenic
962022017 3:131511526-131511548 TTTGTTAGGATGGCAAAACCAGG + Intergenic
962660846 3:137599044-137599066 TTTGTTAGGATGGCAAAACCAGG - Intergenic
963111626 3:141693440-141693462 TTAGTTAGGAAGGCAAAACCAGG + Intergenic
963319972 3:143801019-143801041 TTTGTTAGGATGGCAAAACCAGG - Intronic
963520647 3:146357119-146357141 TTTGTTAGGATGGCAAAACCAGG - Intergenic
964983817 3:162715957-162715979 TTTGTTAGGATGGCAAAACCAGG - Intergenic
964984657 3:162724533-162724555 TTTGTTAGGATGGCAAAACCAGG + Intergenic
965262446 3:166502925-166502947 TTTGTTAGGATGGCAAAACCAGG + Intergenic
965336541 3:167434784-167434806 TTTGTTAGGATGGCAAAACCAGG - Intergenic
965349338 3:167594625-167594647 TGTGGTAGAAAAGCAAAACCCGG + Intronic
965452790 3:168858948-168858970 AGTGTTACGAAGGCAAAACTGGG - Intergenic
965624653 3:170674507-170674529 TTTGTTAGGATGGCAAAACCAGG + Intronic
965639801 3:170819940-170819962 TTTGTTAGGATGGCAAAACCAGG + Intronic
965861778 3:173158102-173158124 TTTGTTAGGATGGCAAAACCAGG + Intergenic
966085637 3:176064902-176064924 TTTGTTAGGATGGCAAAACCAGG - Intergenic
966279518 3:178211101-178211123 TTTGTTAGTATGGCAAAACCAGG - Intergenic
967624442 3:191668630-191668652 TTTGTTAGGATGGCAAAACCAGG + Intergenic
969003614 4:4002405-4002427 TTTGTTAGGATGGCAAAACCAGG + Intergenic
969653845 4:8484763-8484785 TTTGTTAGGATGGCAAAACCAGG + Intronic
969749244 4:9097781-9097803 TTTGTTAGGATGGCAAAACCAGG - Intergenic
969810309 4:9642418-9642440 TTTGTTAGGATGGCAAAACCAGG - Intergenic
970029020 4:11655887-11655909 TTTGTTAGGATGGCAAAACCAGG + Intergenic
970087753 4:12367333-12367355 TTTGTTAGGATGGCAAAACCAGG - Intergenic
973118716 4:46491507-46491529 AGTCTTAGTAAGGAAAAGCCTGG - Intergenic
974425682 4:61740430-61740452 GGTGAAAGTCAGTCAAAACCAGG - Intronic
976558774 4:86478151-86478173 GGTTTTGTTATGGCAAAACCAGG - Intronic
977651641 4:99476746-99476768 GGAGTGAGAAAGGTAAAACCAGG - Intergenic
979171201 4:117602459-117602481 TTTGTTAGGATGGCAAAACCAGG + Intergenic
979237936 4:118422519-118422541 GATGTTAAAAAGGCAAAACTGGG + Intergenic
979602913 4:122606044-122606066 GGTGGTAGTGAGGCAAGACCTGG + Intergenic
980880181 4:138701968-138701990 GGTGCTTGTTAAGCAAAACCAGG - Intergenic
982319049 4:154060004-154060026 TTTGTTAGGATGGCAAAACCAGG - Intergenic
983345764 4:166524091-166524113 TTTGTTAGGATGGCAAAACCAGG - Intergenic
983448233 4:167879676-167879698 TTTGTTAGGATGGCAAAACCAGG - Intergenic
983883554 4:172958512-172958534 TTTGTTAGGATGGCAAAACCAGG + Intronic
984098843 4:175463584-175463606 TTTGTTAGGATGGCAAAACCAGG + Intergenic
985057191 4:186046346-186046368 TTTGTTAGGATGGCAAAACCAGG + Intergenic
985435919 4:189929420-189929442 TTTGTTAGGATGGCAAAACCAGG - Intergenic
986554840 5:9000689-9000711 TTTGTTAGGATGGCAAAACCAGG + Intergenic
995547011 5:113242868-113242890 GGAGTCAGTCAGGCAAGACCCGG + Intronic
996745228 5:126841698-126841720 TTTGTTAGGATGGCAAAACCAGG + Intergenic
996963850 5:129284828-129284850 GGTGTTCGTAAGTCAGAAACTGG + Intergenic
1000885116 5:166741243-166741265 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1001354061 5:171003370-171003392 TTTGTTAGGATGGCAAAACCAGG + Intronic
1002738367 5:181414502-181414524 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1003388643 6:5692832-5692854 GGTGTCAGAAAGGCCAAATCAGG + Intronic
1004837211 6:19542469-19542491 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1009761433 6:68011943-68011965 GATGTGATAAAGGCAAAACCAGG + Intergenic
1011352148 6:86434712-86434734 GGTGGGAGCAAGGCAAAAACAGG - Intergenic
1011367695 6:86600517-86600539 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1012513122 6:100027297-100027319 GGTGGAAGTAAGGCAAAGTCTGG + Intergenic
1012678814 6:102153235-102153257 AGTGATAGGAAGGTAAAACCAGG - Intergenic
1014115116 6:117661697-117661719 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1015165417 6:130195885-130195907 TTTGTTAGGATGGCAAAACCAGG - Intronic
1015445355 6:133297567-133297589 GGTGTTAGTAAGGCAAAACCAGG - Intronic
1016249073 6:142019373-142019395 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1018135927 6:160778446-160778468 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1018749887 6:166795159-166795181 GGTATTAATAAAGCAAAACCTGG + Intronic
1018991737 6:168678972-168678994 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1019243469 6:170690054-170690076 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1020323751 7:6958859-6958881 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1020984681 7:15118759-15118781 GGTGGTACTAATGGAAAACCAGG - Intergenic
1021393826 7:20124160-20124182 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1021637554 7:22706972-22706994 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1022572583 7:31469178-31469200 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1022709284 7:32835932-32835954 GGTTTTAGAATGGCAAAACCAGG - Intergenic
1023566612 7:41529575-41529597 AGTGGTAGGAAGGCAAAAACAGG - Intergenic
1023672652 7:42594208-42594230 GGTGTTAGGAAGTCCAAAACGGG - Intergenic
1026469364 7:70681770-70681792 GGTATTTGTAATGCAAAAACTGG + Intronic
1027158550 7:75785655-75785677 TTTGTTAGGATGGCAAAACCAGG - Intronic
1027339952 7:77196343-77196365 GGTGTAAGTGAGGCACACCCTGG - Exonic
1027717606 7:81692733-81692755 GGCATTAGTCAGGCAAAAGCTGG + Intergenic
1028589664 7:92481763-92481785 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1029051870 7:97698097-97698119 GGTATTATAAAGGTAAAACCAGG - Intergenic
1029317408 7:99726996-99727018 TTTGTTAGGATGGCAAAACCAGG - Intronic
1029947994 7:104553749-104553771 GATGTTAGTATGGCAAAAGAGGG - Intronic
1031296818 7:120012445-120012467 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1031422238 7:121565968-121565990 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1031777544 7:125921137-125921159 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1033088758 7:138366088-138366110 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1033464828 7:141580976-141580998 TTTGTTAGGATGGCAAAACCAGG + Intronic
1035504653 8:118104-118126 GATGTTAAAAAGGCAAAACTGGG - Intergenic
1035880464 8:3240362-3240384 TTTGTTAGGATGGCAAAACCAGG + Intronic
1036070716 8:5438784-5438806 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1036639714 8:10574997-10575019 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1038094564 8:24293405-24293427 GGTGGTAGTAAGGCTAAACTGGG - Intergenic
1039498764 8:38000673-38000695 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1040648223 8:49423091-49423113 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1044683600 8:94806040-94806062 TGTGTTAGTAAGACAAAAACAGG - Intergenic
1046016987 8:108617123-108617145 GGGGTTAGTGAGGCAAAATTAGG + Intronic
1048143969 8:131822755-131822777 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1048764038 8:137826966-137826988 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1049868592 8:144956242-144956264 CTTGTTAGGATGGCAAAACCAGG + Intergenic
1050117821 9:2279126-2279148 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1050257887 9:3813312-3813334 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1052163284 9:25291244-25291266 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1053058232 9:35007050-35007072 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1054807277 9:69406897-69406919 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1055626935 9:78184375-78184397 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1056028379 9:82525058-82525080 GGTGTAATTAAGCCAAAATCAGG - Intergenic
1056363918 9:85884261-85884283 TCTGTTAGGATGGCAAAACCAGG - Intergenic
1057812376 9:98267961-98267983 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1059145941 9:111899319-111899341 AGTGTTTGTAAGGCAAAATGGGG - Intronic
1059863282 9:118487817-118487839 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1061254842 9:129448837-129448859 GGTGTTTGTAATGCAGAATCTGG + Intergenic
1203603658 Un_KI270748v1:39277-39299 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1187119689 X:16392238-16392260 GGAGTTACTTTGGCAAAACCTGG + Intergenic
1187480584 X:19651421-19651443 GGTGTTACAAAGGTAAACCCTGG - Intronic
1188200716 X:27291118-27291140 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1188300865 X:28504698-28504720 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1188419708 X:29978899-29978921 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1188552868 X:31381066-31381088 TTTGTTAGGATGGCAAAACCAGG - Intronic
1191761515 X:64652630-64652652 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1193820757 X:86161379-86161401 GGTGTTAGCAGATCAAAACCTGG + Intronic
1194660891 X:96627594-96627616 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1194873589 X:99161577-99161599 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1194936029 X:99949939-99949961 GGTTTTAGCAATGAAAAACCTGG - Intergenic
1195326642 X:103763925-103763947 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1195532216 X:105969904-105969926 TGTGTTTGTAAGGCAGAACATGG - Intergenic
1196992466 X:121345144-121345166 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1197499920 X:127230156-127230178 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1198065397 X:133091482-133091504 GGTGTTAAAAAGTCAAAATCAGG + Intronic
1198966136 X:142230122-142230144 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1198983551 X:142425715-142425737 TTTGTTAGGATGGCAAAACCAGG + Intergenic
1200424292 Y:3004887-3004909 AGTGTTTGTAGGGCAAACCCAGG + Intergenic
1201937353 Y:19422698-19422720 TTTGTTAGGATGGCAAAACCAGG - Intergenic
1202385723 Y:24324320-24324342 GATGTTAAAAAGGCAAAACTGGG + Intergenic
1202485063 Y:25345808-25345830 GATGTTAAAAAGGCAAAACTGGG - Intergenic