ID: 1015447125

View in Genome Browser
Species Human (GRCh38)
Location 6:133319177-133319199
Sequence GAGGGAAGAATTCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015447121_1015447125 1 Left 1015447121 6:133319153-133319175 CCTCTCTTCACTGCTATAAGAGA No data
Right 1015447125 6:133319177-133319199 GAGGGAAGAATTCAACCCCAGGG No data
1015447120_1015447125 11 Left 1015447120 6:133319143-133319165 CCTCATAAAACCTCTCTTCACTG No data
Right 1015447125 6:133319177-133319199 GAGGGAAGAATTCAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015447125 Original CRISPR GAGGGAAGAATTCAACCCCA GGG Intronic